Stem-loop sequence mml-mir-486

AccessionMI0007759 (change log)
DescriptionMacaca mulatta miR-486 stem-loop
Gene family MIPF0000220; mir-486
                            -  ggg a 
5' guauccuguacugagcugccccgag cu   c g
   ||||||||||||||||||||||||| ||   | c
3' cguaggacaugacucgacggggcuc gg   g a
                            c  gaa u 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 43115013-43115080 [-]
ENSMMUT00000015248 ; KAT6A-201; intron 1
Database links

Mature sequence mml-miR-486-5p

Accession MIMAT0006344

4 - 


 - 25

Get sequence
Evidence by similarity; MI0002470
Database links
Predicted targets

Mature sequence mml-miR-486-3p

Accession MIMAT0006345

46 - 


 - 66

Get sequence
Evidence by similarity; MI0002470
Predicted targets
