Stem-loop sequence mml-mir-486

Accession MI0007759
Description Macaca mulatta miR-486 stem-loop
Gene family MIPF0000220; mir-486
                            -  ggg a 
5' guauccuguacugagcugccccgag cu   c g
   ||||||||||||||||||||||||| ||   | c
3' cguaggacaugacucgacggggcuc gg   g a
                            c  gaa u 
Get sequence
Deep sequencing
22477 reads, 312 reads per million, 8 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 42566248-42566315 [+]
ENSMMUT00000015248 ; KAT6A-201; intron 1
Database links

Mature sequence mml-miR-486-5p

Accession MIMAT0006344

4 - 


 - 25

Get sequence
Deep sequencing 55 reads, 6 experiments
Evidence by similarity; MI0002470
Predicted targets

Mature sequence mml-miR-486-3p

Accession MIMAT0006345

46 - 


 - 66

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence by similarity; MI0002470
Predicted targets
