Stem-loop sequence mml-mir-486

Accession MI0007759
Description Macaca mulatta miR-486 stem-loop
Gene family MIPF0000220; mir-486
Stem-loop
                         -  ggg a 
guauccuguacugagcugccccgag cu   c g
||||||||||||||||||||||||| ||   | c
cguaggacaugacucgacggggcuc gg   g a
                         c  gaa u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
8: 42215501-42215568 [+]
antisense
ENSMMUT00000020656 ; ANK1-205; intron 2
ENSMMUT00000039046 ; ANK1-202; intron 3
ENSMMUT00000020660 ; ANK1-203; intron 43
ENSMMUT00000020653 ; ANK1-204; intron 43
ENSMMUT00000039047 ; ANK1-201; intron 45
Database links

Mature sequence mml-miR-486-5p

Accession MIMAT0006344
Sequence

4 - 

uccuguacugagcugccccgag

 - 25

Get sequence
Evidence by similarity; MI0002470
Predicted targets

Mature sequence mml-miR-486-3p

Accession MIMAT0006345
Sequence

46 - 

cggggcagcucaguacaggau

 - 66

Get sequence
Evidence by similarity; MI0002470
Predicted targets

References

1