Stem-loop sequence mml-mir-485

AccessionMI0007758 (change log)
DescriptionMacaca mulatta miR-485 stem-loop
Gene family MIPF0000201; mir-485
Stem-loop
      ug        cu       -    a    auuc 
5' acu  gagagagg  ggccgug auga uucg    a
   |||  ||||||||  ||||||| |||| ||||    u
3' uga  uucucucc  ucggcac uacu gagc    c
      uu        uc       a    -    gaaa 
Get sequence
Deep sequencing
2958 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163389434-163389506 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-485
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
mml-mir-487achr7: 163386465-163386544 [+]
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
mml-mir-369chr7: 163399393-163399462 [+]
Database links

Mature sequence mml-miR-485-5p

Accession MIMAT0006342
Sequence

9 - 

agaggcuggccgugaugaauuc

 - 30

Get sequence
Deep sequencing2397 reads, 9 experiments
Evidence by similarity; MI0002469
Database links
Predicted targets

Mature sequence mml-miR-485-3p

Accession MIMAT0006343
Sequence

46 - 

gucauacacggcucuccucucu

 - 67

Get sequence
Deep sequencing536 reads, 9 experiments
Evidence by similarity; MI0002469
Predicted targets

References

1