Stem-loop sequence mml-mir-484

AccessionMI0007757
DescriptionMacaca mulatta miR-484 stem-loop
Gene family MIPF0000219; mir-484
Stem-loop
      cuca   c       au   -c    a 
gucagg    guc ccucccg  aaa  cccu a
||||||    ||| |||||||  |||  ||||  
cggucc    cag ggggggc  uuu  ggga a
      ----   u       cc   ca    u 
Get sequence
Deep sequencing
2395 reads, 36.2 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr20: 15393767-15393829 [+]
sense
ENSMMUT00000014501 ; NDE1-201; intron 3
Database links

Mature sequence mml-miR-484

Accession MIMAT0006341
Sequence

2 - 

ucaggcucaguccccucccgau

 - 23

Get sequence
Deep sequencing25 reads, 5 experiments
Evidence by similarity; MI0002468
Predicted targets

References

1