Stem-loop sequence mml-mir-484

AccessionMI0007757 (change log)
DescriptionMacaca mulatta miR-484 stem-loop
Gene family MIPF0000219; mir-484
Literature search

1 open access papers mention mml-mir-484
(2 sentences)

Stem-loop
         cuca   c       au   -c    a 
5' gucagg    guc ccucccg  aaa  cccu a
   ||||||    ||| |||||||  |||  ||||  
3' cggucc    cag ggggggc  uuu  ggga a
         ----   u       cc   ca    u 
Get sequence
Deep sequencing
4530 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr20: 15445602-15445664 [+]
sense
ENSMMUT00000014501 ; NDE1-201; intron 3
Database links

Mature sequence mml-miR-484

Accession MIMAT0006341
Sequence

2 - 

ucaggcucaguccccucccgau

 - 23

Get sequence
Deep sequencing4530 reads, 9 experiments
Evidence by similarity; MI0002468
Database links
Predicted targets

References

1