Stem-loop sequence mml-mir-484

Accession MI0007757
Description Macaca mulatta miR-484 stem-loop
Gene family MIPF0000219; mir-484
Stem-loop
      cuca   c       au   -c    a 
gucagg    guc ccucccg  aaa  cccu a
||||||    ||| |||||||  |||  ||||  
cggucc    cag ggggggc  uuu  ggga a
      ----   u       cc   ca    u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
20: 15357361-15357423 [+]
sense
ENSMMUT00000036827 ; mml-mir-484-201; exon 1
Database links

Mature sequence mml-miR-484

Accession MIMAT0006341
Sequence

2 - 

ucaggcucaguccccucccgau

 - 23

Get sequence
Evidence by similarity; MI0002468
Predicted targets

References

1