Stem-loop sequence mml-mir-455

AccessionMI0007756 (change log)
DescriptionMacaca mulatta miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   ----ucccu   -g     -----          u      a   c   gaa 
5'          ggc  ugagg     guaugugccu uggacu cau gug   g
            |||  |||||     |||||||||| |||||| ||| |||    
3'          ccg  acucc     cauauacggg accuga gua cac   c
   cuacuguau   ga     guuca          u      c   c   gac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 25201134-25201229 [-]
sense
ENSMMUT00000011978 ; COL27A1-201; intron 10
Database links

Mature sequence mml-miR-455-5p

Accession MIMAT0006339
Sequence

16 - 

uaugugccuuuggacuacaucg

 - 37

Get sequence
Evidence by similarity; MI0003513
Database links
Predicted targets

Mature sequence mml-miR-455-3p

Accession MIMAT0006340
Sequence

54 - 

gcaguccaugggcauauacac

 - 74

Get sequence
Evidence by similarity; MI0003513
Predicted targets

References

1