Stem-loop sequence mml-mir-455

Accession MI0007756
Description Macaca mulatta miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
----ucccu   -g     -----          u      a   c   gaa 
         ggc  ugagg     guaugugccu uggacu cau gug   g
         |||  |||||     |||||||||| |||||| ||| |||    
         ccg  acucc     cauauacggg accuga gua cac   c
cuacuguau   ga     guuca          u      c   c   gac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
15: 21918824-21918919 [-]
intergenic
Database links

Mature sequence mml-miR-455-5p

Accession MIMAT0006339
Sequence

16 - 

uaugugccuuuggacuacaucg

 - 37

Get sequence
Evidence by similarity; MI0003513
Predicted targets

Mature sequence mml-miR-455-3p

Accession MIMAT0006340
Sequence

54 - 

gcaguccaugggcauauacac

 - 74

Get sequence
Evidence by similarity; MI0003513
Predicted targets

References

1