Stem-loop sequence mml-mir-455

Accession MI0007756
Description Macaca mulatta miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   ----ucccu   -g     -----          u      a   c   gaa 
5'          ggc  ugagg     guaugugccu uggacu cau gug   g
            |||  |||||     |||||||||| |||||| ||| |||    
3'          ccg  acucc     cauauacggg accuga gua cac   c
   cuacuguau   ga     guuca          u      c   c   gac 
Get sequence
Deep sequencing
3040 reads, 45 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr15: 21854612-21854707 [-]
sense
ENSMMUT00000011978 ; COL27A1-201; intron 10
Database links

Mature sequence mml-miR-455-5p

Accession MIMAT0006339
Sequence

16 - 

uaugugccuuuggacuacaucg

 - 37

Get sequence
Deep sequencing 346 reads, 6 experiments
Evidence by similarity; MI0003513
Predicted targets

Mature sequence mml-miR-455-3p

Accession MIMAT0006340
Sequence

54 - 

gcaguccaugggcauauacac

 - 74

Get sequence
Deep sequencing 10 reads, 2 experiments
Evidence by similarity; MI0003513
Predicted targets

References

1