Stem-loop sequence mml-mir-454

Accession MI0007755
Description Macaca mulatta miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
-------uc     a  a     uc            ---         ----   --u     g 
         uguuu uc ccaga  cuagaacccuau   caauauugu    cuc   gcugu u
         ||||| || |||||  ||||||||||||   |||||||||    |||   |||||  
         acaag ag gguuu  gguuuugggaua   guuauaacg    gag   ugaua a
ggacgggua     a  -     gu            uuc         ugau   ucu     a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 43381611-43381725 [-]
intergenic
Database links

Mature sequence mml-miR-454-5p

Accession MIMAT0026880
Sequence

28 - 

uaucaauauugucucugc

 - 45

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-454-3p

Accession MIMAT0006338
Sequence

64 - 

uagugcaauauugcuuauagggu

 - 86

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).