Stem-loop sequence mml-mir-453

AccessionMI0007754
DescriptionMacaca mulatta miR-453 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   ----g     c       agugccaccucaugguacuc 
gca     gaaug ugugagc                    g
|||     ||||| |||||||                     
cgu     uuuau acgcuug                    g
   aguaa     u       aguggugccuguuggaggga 
Get sequence
Deep sequencing
30 reads, 1.28 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-453

Accession MIMAT0006337
Sequence

44 - 

agguuguccguggugaguucgca

 - 66

Get sequence
Evidence by similarity; MI0001727
Predicted targets

References

1