Dead miRNA entry

miRNA accession:
MI0007754
miRNA ID:
mml-mir-453
Forward to:
MI0023688
Comment:
mir-323b and mir-453 map to the same genomic locus in the Mmul_8.0.1 genome assembly, so the entries are merged.

Previous miRNA entry

Stem-loop sequence mml-mir-453

AccessionMI0007754 (change log)
DescriptionMacaca mulatta miR-453 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
      ----g     c       agugccaccucaugguacuc 
5' gca     gaaug ugugagc                    g
   |||     ||||| |||||||                     
3' cgu     uuuau acgcuug                    g
      aguaa     u       aguggugccuguuggaggga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-453

Accession MIMAT0006337
Sequence

44 - 

agguuguccguggugaguucgca

 - 66

Get sequence
Evidence by similarity; MI0001727
Predicted targets

References

1