Stem-loop sequence mml-mir-452

AccessionMI0007753 (change log)
DescriptionMacaca mulatta miR-452 stem-loop
Gene family MIPF0000287; mir-452
Stem-loop
     u          aac g        g  a        uuug 
5' gc aagcacuuac   u uuugcaga ga acugagac    u
   || ||||||||||   | |||||||| || ||||||||    a
3' cg uucgugaaug   a aaacgucu cu ugacucug    a
     u          --a g        a  c        uauc 
Get sequence
Deep sequencing
57919 reads, 289 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 145594534-145594618 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-452
mml-mir-452chrX: 145594534-145594618 [-]
mml-mir-224chrX: 145593499-145593579 [-]
Database links

Mature sequence mml-miR-452-5p

Accession MIMAT0006336
Sequence

14 - 

aacuguuugcagaggaaacuga

 - 35

Get sequence
Deep sequencing57349 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-452-3p

Accession MIMAT0026879
Sequence

55 - 

agucucaucugcaaagaaguaa

 - 76

Get sequence
Deep sequencing561 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).