|
miRBase |
|
Stem-loop sequence mml-mir-452 |
||||||
| Accession | MI0007753 | |||||
| Description | Macaca mulatta miR-452 stem-loop | |||||
| Gene family | MIPF0000287; mir-452 | |||||
| Stem-loop |
u aac g g a uuug gc aagcacuuac u uuugcaga ga acugagac u || |||||||||| | |||||||| || |||||||| a cg uucgugaaug a aaacgucu cu ugacucug a u --a g a c uauc |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence mml-miR-452 |
|
| Accession | MIMAT0006336 |
| Sequence |
14 - aacuguuugcagaggaaacuga - 35 |
| Evidence | by similarity; MI0001733 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|