Stem-loop sequence mml-mir-451

AccessionMI0007752 (change log)
DescriptionMacaca mulatta miR-451 stem-loop
Gene family MIPF0000148; mir-451
Literature search

1 open access papers mention mml-mir-451
(5 sentences)

Stem-loop
   c     a        ga    g            a 
5'  uuggg auggcaag  aacc uuaccauuacug g
    ||||| ||||||||  |||| ||||||||||||  
3'  gaccu uaucguuc  uugg aaugguaaugau u
   a     a        uc    g            u 
Get sequence
Deep sequencing
546332 reads, 2.88e+03 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 22890441-22890512 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-451
mml-mir-144chr16: 22890605-22890690 [-]
mml-mir-451chr16: 22890441-22890512 [-]
Database links

Mature sequence mml-miR-451

Accession MIMAT0006335
Sequence

17 - 

aaaccguuaccauuacugaguu

 - 38

Get sequence
Deep sequencing546267 reads, 9 experiments
Evidence by similarity; MI0001729
Database links
Predicted targets

References

1