Stem-loop sequence mml-mir-450b

AccessionMI0007751 (change log)
DescriptionMacaca mulatta miR-450b stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
   --          uuu     u   u    g       ag 
5'   gcagaauuau   ugcaa aug uccu aauaugu  u
     ||||||||||   ||||| ||| |||| |||||||  a
3'   uguuuugaua   acguu uac aggg uuaugcg  u
   ua          ccu     u   u    -       aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128511981-128512058 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-450b
mml-mir-424chrX: 128518416-128518513 [-]
mml-mir-503chrX: 128518109-128518179 [-]
mml-mir-542chrX: 128513131-128513227 [-]
mml-mir-450a-2chrX: 128512304-128512403 [-]
mml-mir-450a-1chrX: 128512137-128512227 [-]
mml-mir-450bchrX: 128511981-128512058 [-]
Database links

Mature sequence mml-miR-450b-5p

Accession MIMAT0006333
Sequence

11 - 

uuuugcaauauguuccugaaua

 - 32

Get sequence
Evidence by similarity; MI0005531
Database links
Predicted targets

Mature sequence mml-miR-450b-3p

Accession MIMAT0006334
Sequence

48 - 

uugggaucauuuugcauccaua

 - 69

Get sequence
Evidence by similarity; MI0005531
Predicted targets

References

1