|
miRBase |
|
Stem-loop sequence mml-mir-450b |
|||||
| Accession | MI0007751 | ||||
| Description | Macaca mulatta miR-450b stem-loop | ||||
| Gene family | MIPF0000128; mir-450 | ||||
| Stem-loop |
-- uuu u u g ag gcagaauuau ugcaa aug uccu aauaugu u |||||||||| ||||| ||| |||| ||||||| a uguuuugaua acguu uac aggg uuaugcg u ua ccu u u - aa |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence mml-miR-450b-5p |
|
| Accession | MIMAT0006333 |
| Sequence |
11 - uuuugcaauauguuccugaaua - 32 |
| Evidence | by similarity; MI0005531 |
| Predicted targets |
|
Mature sequence mml-miR-450b-3p |
|
| Accession | MIMAT0006334 |
| Sequence |
48 - uugggaucauuuugcauccaua - 69 |
| Evidence | by similarity; MI0005531 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|