Stem-loop sequence mml-mir-450b

AccessionMI0007751
DescriptionMacaca mulatta miR-450b stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
--          uuu     u   u    g       ag 
  gcagaauuau   ugcaa aug uccu aauaugu  u
  ||||||||||   ||||| ||| |||| |||||||  a
  uguuuugaua   acguu uac aggg uuaugcg  u
ua          ccu     u   u    -       aa 
Get sequence
Deep sequencing
1432 reads, 90 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-450b-5p

Accession MIMAT0006333
Sequence

11 - 

uuuugcaauauguuccugaaua

 - 32

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence by similarity; MI0005531
Predicted targets

Mature sequence mml-miR-450b-3p

Accession MIMAT0006334
Sequence

48 - 

uugggaucauuuugcauccaua

 - 69

Get sequence
Evidence by similarity; MI0005531
Predicted targets

References

1