Stem-loop sequence mml-mir-450b

Accession MI0007751
Description Macaca mulatta miR-450b stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
--          uuu     u   u    g       ag 
  gcagaauuau   ugcaa aug uccu aauaugu  u
  ||||||||||   ||||| ||| |||| |||||||  a
  uguuuugaua   acguu uac aggg uuaugcg  u
ua          ccu     u   u    -       aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 132765568-132765645 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-450b
mml-mir-424 X: 132772003-132772100 [-]
mml-mir-503 X: 132771696-132771766 [-]
mml-mir-542 X: 132766718-132766814 [-]
mml-mir-450a-2 X: 132765891-132765990 [-]
mml-mir-450a-1 X: 132765724-132765814 [-]
mml-mir-450b X: 132765568-132765645 [-]
Database links

Mature sequence mml-miR-450b-5p

Accession MIMAT0006333
Sequence

11 - 

uuuugcaauauguuccugaaua

 - 32

Get sequence
Evidence by similarity; MI0005531
Predicted targets

Mature sequence mml-miR-450b-3p

Accession MIMAT0006334
Sequence

48 - 

uugggaucauuuugcauccaua

 - 69

Get sequence
Evidence by similarity; MI0005531
Predicted targets

References

1