Stem-loop sequence mml-mir-450a-2

AccessionMI0007750 (change log)
DescriptionMacaca mulatta miR-450a-2 stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
   -ccaaagaaa     u       uuu     u               aa 
5'           gaugc aaacuau   ugcga guguuccuaauaugu  u
             ||||| |||||||   ||||| |||||||||||||||  a
3'           cuaug uuugaua   acguu uacagggguuaugua  u
   gguauaauaa     u       cuu     u               aa 
Get sequence
Deep sequencing
469 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128512304-128512403 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-450a-2
mml-mir-424chrX: 128518416-128518513 [-]
mml-mir-503chrX: 128518109-128518179 [-]
mml-mir-542chrX: 128513131-128513227 [-]
mml-mir-450a-2chrX: 128512304-128512403 [-]
mml-mir-450a-1chrX: 128512137-128512227 [-]
mml-mir-450bchrX: 128511981-128512058 [-]
Database links

Mature sequence mml-miR-450a-5p

Accession MIMAT0006332
Sequence

23 - 

uuuugcgauguguuccuaauau

 - 44

Get sequence
Deep sequencing924 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-450a-2-3p

Accession MIMAT0031019
Sequence

58 - 

auuggggacauuuugcauucau

 - 79

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).