Stem-loop sequence mml-mir-450a-2

Accession MI0007750
Description Macaca mulatta miR-450a-2 stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
   -ccaaagaaa     u       uuu     u               aa 
5'           gaugc aaacuau   ugcga guguuccuaauaugu  u
             ||||| |||||||   ||||| |||||||||||||||  a
3'           cuaug uuugaua   acguu uacagggguuaugua  u
   gguauaauaa     u       cuu     u               aa 
Get sequence
Deep sequencing
142 reads, 11 reads per million, 7 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 133862710-133862809 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-450a-2
mml-mir-503 chrX: 133868518-133868588 [-]
mml-mir-542 chrX: 133863537-133863633 [-]
mml-mir-450a-2 chrX: 133862710-133862809 [-]
mml-mir-450a-1 chrX: 133862543-133862633 [-]
Database links

Mature sequence mml-miR-450a-5p

Accession MIMAT0006332
Sequence

23 - 

uuuugcgauguguuccuaauau

 - 44

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-450a-2-3p

Accession MIMAT0031019
Sequence

58 - 

auuggggacauuuugcauucau

 - 79

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).