Stem-loop sequence mml-mir-450a-2

Accession MI0007750
Description Macaca mulatta miR-450a-2 stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
-ccaaagaaa     u       uuu     u               aa 
          gaugc aaacuau   ugcga guguuccuaauaugu  u
          ||||| |||||||   ||||| |||||||||||||||  a
          cuaug uuugaua   acguu uacagggguuaugua  u
gguauaauaa     u       cuu     u               aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 132765891-132765990 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-450a-2
mml-mir-424 X: 132772003-132772100 [-]
mml-mir-503 X: 132771696-132771766 [-]
mml-mir-542 X: 132766718-132766814 [-]
mml-mir-450a-2 X: 132765891-132765990 [-]
mml-mir-450a-1 X: 132765724-132765814 [-]
mml-mir-450b X: 132765568-132765645 [-]
Database links

Mature sequence mml-miR-450a-5p

Accession MIMAT0006332
Sequence

23 - 

uuuugcgauguguuccuaauau

 - 44

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-450a-2-3p

Accession MIMAT0031019
Sequence

58 - 

auuggggacauuuugcauucau

 - 79

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).