|
miRBase |
|
Stem-loop sequence mml-mir-450a-1 |
|||||
| Accession | MI0007749 | ||||
| Description | Macaca mulatta miR-450a-1 stem-loop | ||||
| Gene family | MIPF0000128; mir-450 | ||||
| Stem-loop |
--aaa u uu u u ac ugauac aaacug u ugcga guguuccuaauaugu u |||||| |||||| | ||||| ||||||||||||||| a acuaug uuugau g acguu uacaaggguuauaua u auaua u gu u u aa |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence mml-miR-450a |
|
| Accession | MIMAT0006332 |
| Sequence |
18 - uuuugcgauguguuccuaauau - 39 |
| Evidence | by similarity; MI0001652 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|