Stem-loop sequence mml-mir-449b

AccessionMI0007748 (change log)
DescriptionMacaca mulatta miR-449b stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ---------uga  u   u     a     u   uu   a c        u  gu 
5'             cc gaa caggu ggcag gua  guu g uggcugcu ga  c
               || ||| ||||| ||||| |||  ||| | |||||||| ||   
3'             gg cuu guuca ccguc cau  caa c accgacga cu  a
   ucuucuuaaaua  u   c     -     c   --   - -        -  ga 
Get sequence
Deep sequencing
4600 reads, 167 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 56077784-56077880 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-449b
mml-mir-449bchr6: 56077784-56077880 [-]
mml-mir-449achr6: 56077670-56077760 [-]
Database links

Mature sequence mml-miR-449b-5p

Accession MIMAT0006331
Sequence

16 - 

aggcaguguauuguuagcuggc

 - 37

Get sequence
Deep sequencing4513 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-449b-3p

Accession MIMAT0026877
Sequence

55 - 

cagccacaacuacccugccacu

 - 76

Get sequence
Deep sequencing86 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).