Stem-loop sequence mml-mir-449a

AccessionMI0007747 (change log)
DescriptionMacaca mulatta miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   -c      ug     c       -    u          ugaa   g 
5'   ugugug  augag uggcagu guau guuagcuggu    uau u
     ||||||  ||||| ||||||| |||| ||||||||||    |||  
3'   auauac  uauuc gucguca cgua caaucgacua    gua g
   ac      gu     u       a    -          --cg   a 
Get sequence
Deep sequencing
7518 reads, 267 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 56077670-56077760 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-449a
mml-mir-449bchr6: 56077784-56077880 [-]
mml-mir-449achr6: 56077670-56077760 [-]
Database links

Mature sequence mml-miR-449a-5p

Accession MIMAT0006330
Sequence

16 - 

uggcaguguauuguuagcuggu

 - 37

Get sequence
Deep sequencing7458 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-449a-3p

Accession MIMAT0026876
Sequence

56 - 

cagcuaacaugcaacugcuguc

 - 77

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).