Stem-loop sequence mml-mir-433

AccessionMI0007745
DescriptionMacaca mulatta miR-433 stem-loop
Gene family MIPF0000177; mir-433
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-433. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, mir-433 is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. They play roles in development, metabolism and carcinogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ccag      gua   u           u   --------  g     cu 
    ggagaa   cgg gagccugucau auu        ca agagg  a
    ||||||   ||| ||||||||||| |||        || |||||   
    ccucuu   gcu cucggguagua uag        gu ucucc  g
-gga      gug   c           c   gaagaguu  g     ua 
Get sequence
Deep sequencing
1646 reads, 24.4 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164779718-164779810 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-433
mml-mir-337chr7: 164771909-164772001 [+]
mml-mir-665chr7: 164772450-164772521 [+]
mml-mir-431chr7: 164778839-164778952 [+]
mml-mir-433chr7: 164779718-164779810 [+]
mml-mir-127chr7: 164780811-164780907 [+]
mml-mir-432chr7: 164782318-164782411 [+]
mml-mir-136chr7: 164782532-164782623 [+]
Database links

Mature sequence mml-miR-433-5p

Accession MIMAT0026875
Sequence

12 - 

uacggugagccugucauuauuc

 - 33

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-433-3p

Accession MIMAT0006328
Sequence

64 - 

aucaugaugggcuccucggugu

 - 85

Get sequence
Deep sequencing54 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).