Stem-loop sequence mml-mir-433

AccessionMI0007745 (change log)
DescriptionMacaca mulatta miR-433 stem-loop
Gene family MIPF0000177; mir-433
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-433. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, mir-433 is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. They play roles in development, metabolism and carcinogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ccag      gua   u           u   --------  g     cu 
5'     ggagaa   cgg gagccugucau auu        ca agagg  a
       ||||||   ||| ||||||||||| |||        || |||||   
3'     ccucuu   gcu cucggguagua uag        gu ucucc  g
   -gga      gug   c           c   gaagaguu  g     ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163216084-163216176 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-433
mml-mir-337chr7: 163207975-163208067 [+]
mml-mir-665chr7: 163208516-163208587 [+]
mml-mir-431chr7: 163215205-163215318 [+]
mml-mir-433chr7: 163216084-163216176 [+]
mml-mir-127chr7: 163217177-163217273 [+]
mml-mir-432chr7: 163218684-163218777 [+]
mml-mir-136chr7: 163218898-163218989 [+]
Database links

Mature sequence mml-miR-433-5p

Accession MIMAT0026875
Sequence

12 - 

uacggugagccugucauuauuc

 - 33

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-433-3p

Accession MIMAT0006328
Sequence

64 - 

aucaugaugggcuccucggugu

 - 85

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).