Stem-loop sequence mml-mir-433

Accession MI0007745
Description Macaca mulatta miR-433 stem-loop
Gene family MIPF0000177; mir-433
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-433. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, mir-433 is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. They play roles in development, metabolism and carcinogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ccag      gua   u           u   --------  g     cu 
    ggagaa   cgg gagccugucau auu        ca agagg  a
    ||||||   ||| ||||||||||| |||        || |||||   
    ccucuu   gcu cucggguagua uag        gu ucucc  g
-gga      gug   c           c   gaagaguu  g     ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164165830-164165922 [+]
antisense
ENSMMUT00000007702 ; mml-mir-431-201; exon 1
Clustered miRNAs
< 10kb from mml-mir-433
mml-mir-337 7: 164158315-164158407 [+]
mml-mir-665 7: 164158856-164158927 [+]
mml-mir-431 7: 164164951-164165064 [+]
mml-mir-433 7: 164165830-164165922 [+]
mml-mir-127 7: 164166923-164167019 [+]
mml-mir-432 7: 164168430-164168523 [+]
mml-mir-136 7: 164168644-164168735 [+]
Database links

Mature sequence mml-miR-433-5p

Accession MIMAT0026875
Sequence

12 - 

uacggugagccugucauuauuc

 - 33

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-433-3p

Accession MIMAT0006328
Sequence

64 - 

aucaugaugggcuccucggugu

 - 85

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).