Stem-loop sequence mml-mir-432

AccessionMI0007744
DescriptionMacaca mulatta miR-432 stem-loop
Gene family MIPF0000211; mir-432
Stem-loop
u  -  c     u u u     ua       g     a   u uauu 
 ga cu cucca g c uggag  ggucauu ggugg ucc c    u
 || || ||||| | | |||||  ||||||| ||||| ||| |    c
 cu ga gaggu c g accuc  ucgguag ucacc ggg g    c
a  a  u     u u u     -c       g     -   u uauu 
Get sequence
Deep sequencing
6347 reads, 89.6 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164782318-164782411 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-432
mml-mir-665chr7: 164772450-164772521 [+]
mml-mir-431chr7: 164778839-164778952 [+]
mml-mir-433chr7: 164779718-164779810 [+]
mml-mir-127chr7: 164780811-164780907 [+]
mml-mir-432chr7: 164782318-164782411 [+]
mml-mir-136chr7: 164782532-164782623 [+]
Database links

Mature sequence mml-miR-432-5p

Accession MIMAT0006327
Sequence

14 - 

ucuuggaguaggucauugggugg

 - 36

Get sequence
Deep sequencing3177 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-432-3p

Accession MIMAT0026874
Sequence

63 - 

uggauggcuccuccaugucu

 - 82

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).