Stem-loop sequence mml-mir-432

Accession MI0007744
Description Macaca mulatta miR-432 stem-loop
Gene family MIPF0000211; mir-432
Stem-loop
u  -  c     u u u     ua       g     a   u uauu 
 ga cu cucca g c uggag  ggucauu ggugg ucc c    u
 || || ||||| | | |||||  ||||||| ||||| ||| |    c
 cu ga gaggu c g accuc  ucgguag ucacc ggg g    c
a  a  u     u u u     -c       g     -   u uauu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164168430-164168523 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-432
mml-mir-665 7: 164158856-164158927 [+]
mml-mir-431 7: 164164951-164165064 [+]
mml-mir-433 7: 164165830-164165922 [+]
mml-mir-127 7: 164166923-164167019 [+]
mml-mir-432 7: 164168430-164168523 [+]
mml-mir-136 7: 164168644-164168735 [+]
Database links

Mature sequence mml-miR-432-5p

Accession MIMAT0006327
Sequence

14 - 

ucuuggaguaggucauugggugg

 - 36

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-432-3p

Accession MIMAT0026874
Sequence

63 - 

uggauggcuccuccaugucu

 - 82

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).