Stem-loop sequence mml-mir-432

AccessionMI0007744 (change log)
DescriptionMacaca mulatta miR-432 stem-loop
Gene family MIPF0000211; mir-432
Stem-loop
   u  -  c     u u u     ua       g     a   u uauu 
5'  ga cu cucca g c uggag  ggucauu ggugg ucc c    u
    || || ||||| | | |||||  ||||||| ||||| ||| |    c
3'  cu ga gaggu c g accuc  ucgguag ucacc ggg g    c
   a  a  u     u u u     -c       g     -   u uauu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163218684-163218777 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-432
mml-mir-431chr7: 163215205-163215318 [+]
mml-mir-433chr7: 163216084-163216176 [+]
mml-mir-127chr7: 163217177-163217273 [+]
mml-mir-432chr7: 163218684-163218777 [+]
mml-mir-136chr7: 163218898-163218989 [+]
Database links

Mature sequence mml-miR-432-5p

Accession MIMAT0006327
Sequence

14 - 

ucuuggaguaggucauugggugg

 - 36

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-432-3p

Accession MIMAT0026874
Sequence

63 - 

uggauggcuccuccaugucu

 - 82

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).