Stem-loop sequence mml-mir-431

AccessionMI0007743 (change log)
DescriptionMacaca mulatta miR-431 stem-loop
Gene family MIPF0000142; mir-431
Stem-loop
   ---------------ucc  c     c       u          c  u a     ----   aca 
5'                   ug uuguc ugcgagg gucuugcagg cg c ugcag    gcc   c
                     || ||||| ||||||| |||||||||| || | |||||    |||    
3'                   ac agcag acgcucu cgggacguuc gc g acguu    ugg   u
   gcagcaaccacuacuccu  -     a       u          u  u g     gcaa   cag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163215205-163215318 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-431
mml-mir-337chr7: 163207975-163208067 [+]
mml-mir-665chr7: 163208516-163208587 [+]
mml-mir-431chr7: 163215205-163215318 [+]
mml-mir-433chr7: 163216084-163216176 [+]
mml-mir-127chr7: 163217177-163217273 [+]
mml-mir-432chr7: 163218684-163218777 [+]
mml-mir-136chr7: 163218898-163218989 [+]
Database links

Mature sequence mml-miR-431

Accession MIMAT0006326
Sequence

20 - 

ugucuugcaggccgucaugca

 - 40

Get sequence
Evidence by similarity; MI0001721
Predicted targets

References

1