Stem-loop sequence mml-mir-431

AccessionMI0007743
DescriptionMacaca mulatta miR-431 stem-loop
Gene family MIPF0000142; mir-431
Stem-loop
---------------ucc  c     c       u          c  u a     ----   aca 
                  ug uuguc ugcgagg gucuugcagg cg c ugcag    gcc   c
                  || ||||| ||||||| |||||||||| || | |||||    |||    
                  ac agcag acgcucu cgggacguuc gc g acguu    ugg   u
gcagcaaccacuacuccu  -     a       u          u  u g     gcaa   cag 
Get sequence
Deep sequencing
1032 reads, 13.9 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164778839-164778952 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-431
mml-mir-337chr7: 164771909-164772001 [+]
mml-mir-665chr7: 164772450-164772521 [+]
mml-mir-431chr7: 164778839-164778952 [+]
mml-mir-433chr7: 164779718-164779810 [+]
mml-mir-127chr7: 164780811-164780907 [+]
mml-mir-432chr7: 164782318-164782411 [+]
mml-mir-136chr7: 164782532-164782623 [+]
Database links

Mature sequence mml-miR-431

Accession MIMAT0006326
Sequence

20 - 

ugucuugcaggccgucaugca

 - 40

Get sequence
Evidence by similarity; MI0001721
Predicted targets

References

1