Stem-loop sequence mml-mir-431

Accession MI0007743
Description Macaca mulatta miR-431 stem-loop
Gene family MIPF0000142; mir-431
Stem-loop
---------------ucc  c     c       u          c  u a     ----   aca 
                  ug uuguc ugcgagg gucuugcagg cg c ugcag    gcc   c
                  || ||||| ||||||| |||||||||| || | |||||    |||    
                  ac agcag acgcucu cgggacguuc gc g acguu    ugg   u
gcagcaaccacuacuccu  -     a       u          u  u g     gcaa   cag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164164951-164165064 [+]
antisense
ENSMMUT00000007702 ; mml-mir-431-201; exon 1
Clustered miRNAs
< 10kb from mml-mir-431
mml-mir-337 7: 164158315-164158407 [+]
mml-mir-665 7: 164158856-164158927 [+]
mml-mir-431 7: 164164951-164165064 [+]
mml-mir-433 7: 164165830-164165922 [+]
mml-mir-127 7: 164166923-164167019 [+]
mml-mir-432 7: 164168430-164168523 [+]
mml-mir-136 7: 164168644-164168735 [+]
Database links

Mature sequence mml-miR-431

Accession MIMAT0006326
Sequence

20 - 

ugucuugcaggccgucaugca

 - 40

Get sequence
Evidence by similarity; MI0001721
Predicted targets

References

1