Stem-loop sequence mml-mir-429

AccessionMI0007742 (change log)
DescriptionMacaca mulatta miR-429 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   c    g c    ag  -uc          cg       cugg 
5'  gccg c gaug  cg   uuaccagaca  guuagac    c
    |||| | ||||  ||   ||||||||||  |||||||     
3'  cggc g cuac  gc   aauggucugu  uaaucug    u
   -    - c    cu  caa          ca       ucuc 
Get sequence
Deep sequencing
45802 reads, 322 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 261052-261134 [+]
antisense
ENSMMUT00000019466 ; CPSF3L-204; intron 2
ENSMMUT00000019462 ; CPSF3L-205; intron 2
ENSMMUT00000019463 ; CPSF3L-202; intron 4
ENSMMUT00000047666 ; CPSF3L-201; intron 5
ENSMMUT00000019472 ; CPSF3L-206; intron 5
ENSMMUT00000047665 ; CPSF3L-203; intron 7
Clustered miRNAs
< 10kb from mml-mir-429
mml-mir-200achr1: 259981-260070 [+]
mml-mir-429chr1: 261052-261134 [+]
Database links

Mature sequence mml-miR-429-5p

Accession MIMAT0026873
Sequence

16 - 

gucuuaccagacacgguuaga

 - 36

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-429-3p

Accession MIMAT0006325
Sequence

51 - 

uaauacugucugguaaaaccgu

 - 72

Get sequence
Deep sequencing45798 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).