Stem-loop sequence mml-mir-424

AccessionMI0007740 (change log)
DescriptionMacaca mulatta miR-424 stem-loop
Gene family MIPF0000164; mir-322
   ---------------------       a  c      aa             g   u 
5'                      cgagggg ua agcagc  uucauguuuugaa ugu c
                        ||||||| || ||||||  ||||||||||||| ||| u
3'                      gcucccc au ucgucg  gagugcaaaacuu gua a
   gggguggaagauggaaggggu       c  a      cg             g   a 
Get sequence
Deep sequencing
33905 reads, 567 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128518416-128518513 [-]
Clustered miRNAs
< 10kb from mml-mir-424
mml-mir-424chrX: 128518416-128518513 [-]
mml-mir-503chrX: 128518109-128518179 [-]
mml-mir-542chrX: 128513131-128513227 [-]
mml-mir-450a-2chrX: 128512304-128512403 [-]
mml-mir-450a-1chrX: 128512137-128512227 [-]
mml-mir-450bchrX: 128511981-128512058 [-]
Database links

Mature sequence mml-miR-424-5p

Accession MIMAT0006323

11 - 


 - 32

Get sequence
Deep sequencing33163 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-424-3p

Accession MIMAT0026872

49 - 


 - 69

Get sequence
Deep sequencing737 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets


PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).