Stem-loop sequence mml-mir-424

Accession MI0007740
Description Macaca mulatta miR-424 stem-loop
Gene family MIPF0000164; mir-322
Stem-loop
---------------------       a  c      aa             g   u 
                     cgagggg ua agcagc  uucauguuuugaa ugu c
                     ||||||| || ||||||  ||||||||||||| ||| u
                     gcucccc au ucgucg  gagugcaaaacuu gua a
gggguggaagauggaaggggu       c  a      cg             g   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 132772003-132772100 [-]
sense
ENSMMUT00000032421 ; 5'UTR (exon 1)
Clustered miRNAs
< 10kb from mml-mir-424
mml-mir-424 X: 132772003-132772100 [-]
mml-mir-503 X: 132771696-132771766 [-]
mml-mir-542 X: 132766718-132766814 [-]
mml-mir-450a-2 X: 132765891-132765990 [-]
mml-mir-450a-1 X: 132765724-132765814 [-]
mml-mir-450b X: 132765568-132765645 [-]
Database links

Mature sequence mml-miR-424-5p

Accession MIMAT0006323
Sequence

11 - 

cagcagcaauucauguuuugaa

 - 32

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-424-3p

Accession MIMAT0026872
Sequence

49 - 

aaaacgugaggcgcugcuaua

 - 69

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).