Stem-loop sequence mml-mir-424

AccessionMI0007740
DescriptionMacaca mulatta miR-424 stem-loop
Gene family MIPF0000164; mir-322
Stem-loop
---------------------       a  c      aa             g   u 
                     cgagggg ua agcagc  uucauguuuugaa ugu c
                     ||||||| || ||||||  ||||||||||||| ||| u
                     gcucccc au ucgucg  gagugcaaaacuu gua a
gggguggaagauggaaggggu       c  a      cg             g   a 
Get sequence
Deep sequencing
27553 reads, 1.72e+03 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-424-5p

Accession MIMAT0006323
Sequence

11 - 

cagcagcaauucauguuuugaa

 - 32

Get sequence
Deep sequencing135 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-424-3p

Accession MIMAT0026872
Sequence

49 - 

aaaacgugaggcgcugcuaua

 - 69

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).