Stem-loop sequence mml-mir-423

AccessionMI0007739 (change log)
DescriptionMacaca mulatta miR-423 stem-loop
Gene family MIPF0000329; mir-423
Stem-loop
   -----auaa       u            -ag   g    a     cua 
5'          aggaagu aggcugaggggc   aga cgag cuuuu   u
            ||||||| ||||||||||||   ||| |||| |||||   u
3'          uccuucg ucugacuccccg   ucu gcuc gaaaa   u
   cgcgcccca       u            gag   g    -     ccu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 24183848-24183941 [+]
intergenic
Database links

Mature sequence mml-miR-423-5p

Accession MIMAT0006321
Sequence

17 - 

ugaggggcagagagcgagacuuu

 - 39

Get sequence
Evidence by similarity; MI0001445
Database links
Predicted targets

Mature sequence mml-miR-423-3p

Accession MIMAT0006322
Sequence

53 - 

agcucggucugaggccccucagu

 - 75

Get sequence
Evidence by similarity; MI0001445
Database links
Predicted targets

References

1