Stem-loop sequence mml-mir-423

Accession MI0007739
Description Macaca mulatta miR-423 stem-loop
Gene family MIPF0000329; mir-423
Stem-loop
-----auaa       u            -ag   g    a     cua 
         aggaagu aggcugaggggc   aga cgag cuuuu   u
         ||||||| ||||||||||||   ||| |||| |||||   u
         uccuucg ucugacuccccg   ucu gcuc gaaaa   u
cgcgcccca       u            gag   g    -     ccu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 25356203-25356296 [+]
sense
ENSMMUT00000016966 ; MMU.12641-201; intron 1
ENSMMUT00000036579 ; mml-mir-423-201; exon 1
Database links

Mature sequence mml-miR-423-5p

Accession MIMAT0006321
Sequence

17 - 

ugaggggcagagagcgagacuuu

 - 39

Get sequence
Evidence by similarity; MI0001445
Predicted targets

Mature sequence mml-miR-423-3p

Accession MIMAT0006322
Sequence

53 - 

agcucggucugaggccccucagu

 - 75

Get sequence
Evidence by similarity; MI0001445
Predicted targets

References

1