Stem-loop sequence mml-mir-422a

Accession MI0007738
Description Macaca mulatta miR-422a stem-loop
Gene family MIPF0000548; mir-422
Stem-loop
-----   a  ---a  ac   a       u  g a     ga    c c 
     gag ga    gc  ugg cucaggg ca a ggccu  gucu c u
     ||| ||    ||  ||| ||||||| || | |||||  |||| | g
     cuc cu    cg  acc gaguccc gu u ucggg  uaga g c
ggucc   -  guuc  -a   -       u  g g     --    c u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 42249639-42249728 [-]
intergenic
Database links

Mature sequence mml-miR-422a

Accession MIMAT0006320
Sequence

10 - 

acuggacucagggucagaaggc

 - 31

Get sequence
Evidence by similarity; MI0001444
Predicted targets

References

1