Stem-loop sequence mml-mir-422a

AccessionMI0007738
DescriptionMacaca mulatta miR-422a stem-loop
Gene family MIPF0000548; mir-422
Stem-loop
-----   a  ---a  ac   a       u  g a     ga    c c 
     gag ga    gc  ugg cucaggg ca a ggccu  gucu c u
     ||| ||    ||  ||| ||||||| || | |||||  |||| | g
     cuc cu    cg  acc gaguccc gu u ucggg  uaga g c
ggucc   -  guuc  -a   -       u  g g     --    c u 
Get sequence
Deep sequencing
1 reads, 1.28 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 41916929-41917018 [-]
antisense
ENSMMUT00000040454 ; USP3-203; intron 1
ENSMMUT00000016959 ; USP3-201; intron 2
ENSMMUT00000040455 ; USP3-202; intron 3
Database links

Mature sequence mml-miR-422a

Accession MIMAT0006320
Sequence

10 - 

acuggacucagggucagaaggc

 - 31

Get sequence
Evidence by similarity; MI0001444
Predicted targets

References

1