Stem-loop sequence mml-mir-421

AccessionMI0007737 (change log)
DescriptionMacaca mulatta miR-421 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
       uu      -    uua            a   aaa 
5' caca  guaggc cuca   aauguuuguuga uga   a
   ||||  |||||| ||||   |||||||||||| |||   a
3' gugu  cguccg gggu   uuacagacaacu acu   u
       cu      c    uaa            -   aag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 68771903-68771981 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-421
mml-mir-374bchrX: 68772068-68772139 [-]
mml-mir-421chrX: 68771903-68771981 [-]
Database links

Mature sequence mml-miR-421

Accession MIMAT0006319
Sequence

47 - 

aucaacagacauuaauugggcgc

 - 69

Get sequence
Evidence by similarity; MI0003685
Predicted targets

References

1