Stem-loop sequence mml-mir-421

Accession MI0007737
Description Macaca mulatta miR-421 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
    uu      -    uua            a   aaa 
caca  guaggc cuca   aauguuuguuga uga   a
||||  |||||| ||||   |||||||||||| |||   a
gugu  cguccg gggu   uuacagacaacu acu   u
    cu      c    uaa            -   aag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 73311841-73311919 [-]
sense
ENSMMUT00000036734 ; mml-mir-421-201; exon 1
Clustered miRNAs
< 10kb from mml-mir-421
mml-mir-374b X: 73312006-73312077 [-]
mml-mir-421 X: 73311841-73311919 [-]
Database links

Mature sequence mml-miR-421

Accession MIMAT0006319
Sequence

47 - 

aucaacagacauuaauugggcgc

 - 69

Get sequence
Evidence by similarity; MI0003685
Predicted targets

References

1