Stem-loop sequence mml-mir-421

Accession MI0007737
Description Macaca mulatta miR-421 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
       uu      -    uua            a   aaa 
5' caca  guaggc cuca   aauguuuguuga uga   a
   ||||  |||||| ||||   |||||||||||| |||   a
3' gugu  cguccg gggu   uuacagacaacu acu   u
       cu      c    uaa            -   aag 
Get sequence
Deep sequencing
966 reads, 16.2 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 73878069-73878147 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-421
mml-mir-374b chrX: 73878234-73878305 [-]
mml-mir-421 chrX: 73878069-73878147 [-]
Database links

Mature sequence mml-miR-421

Accession MIMAT0006319
Sequence

47 - 

aucaacagacauuaauugggcgc

 - 69

Get sequence
Evidence by similarity; MI0003685
Predicted targets

References

1