Stem-loop sequence mml-mir-412

AccessionMI0007736 (change log)
DescriptionMacaca mulatta miR-412 stem-loop
Gene family MIPF0000192; mir-412
Stem-loop
   ----cug      gg      a    c      u   aa    -    u 
5'        ggguac  ggaugg uggu gaccag ugg  agua auug u
          ||||||  |||||| |||| |||||| |||  |||| ||||  
3'        ccuaug  ccugcc auca cugguc acu  ucau uaau u
   gacgucg      --      g    c      c   --    g    c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163399243-163399333 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-412
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
mml-mir-369chr7: 163399393-163399462 [+]
mml-mir-410chr7: 163399706-163399785 [+]
mml-mir-656chr7: 163400519-163400596 [+]
Database links

Mature sequence mml-miR-412-5p

Accession MIMAT0026871
Sequence

19 - 

uggucgaccaguuggaaagu

 - 38

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-412-3p

Accession MIMAT0006318
Sequence

54 - 

acuucaccugguccacuagccgu

 - 76

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).