Stem-loop sequence mml-mir-412

AccessionMI0007736
DescriptionMacaca mulatta miR-412 stem-loop
Gene family MIPF0000192; mir-412
Stem-loop
----cug      gg      a    c      u   aa    -    u 
       ggguac  ggaugg uggu gaccag ugg  agua auug u
       ||||||  |||||| |||| |||||| |||  |||| ||||  
       ccuaug  ccugcc auca cugguc acu  ucau uaau u
gacgucg      --      g    c      c   --    g    c 
Get sequence
Deep sequencing
654 reads, 10.1 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164963813-164963903 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-412
mml-mir-485chr7: 164953852-164953924 [+]
mml-mir-323bchr7: 164954659-164954715 [+]
mml-mir-154chr7: 164958168-164958251 [+]
mml-mir-496chr7: 164959019-164959120 [+]
mml-mir-377chr7: 164960414-164960482 [+]
mml-mir-541chr7: 164962858-164962941 [+]
mml-mir-409chr7: 164963666-164963744 [+]
mml-mir-412chr7: 164963813-164963903 [+]
mml-mir-369chr7: 164963963-164964032 [+]
mml-mir-410chr7: 164964276-164964355 [+]
mml-mir-656chr7: 164965089-164965166 [+]
Database links

Mature sequence mml-miR-412-5p

Accession MIMAT0026871
Sequence

19 - 

uggucgaccaguuggaaagu

 - 38

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-412-3p

Accession MIMAT0006318
Sequence

54 - 

acuucaccugguccacuagccgu

 - 76

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).