Stem-loop sequence mml-mir-412

Accession MI0007736
Description Macaca mulatta miR-412 stem-loop
Gene family MIPF0000192; mir-412
Stem-loop
----cug      gg      a    c      u   aa    -    u 
       ggguac  ggaugg uggu gaccag ugg  agua auug u
       ||||||  |||||| |||| |||||| |||  |||| ||||  
       ccuaug  ccugcc auca cugguc acu  ucau uaau u
gacgucg      --      g    c      c   --    g    c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164349098-164349188 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-412
mml-mir-668 7: 164339183-164339248 [+]
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-323b 7: 164340154-164340210 [+]
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
mml-mir-541 7: 164348143-164348226 [+]
mml-mir-409 7: 164348951-164349029 [+]
mml-mir-412 7: 164349098-164349188 [+]
mml-mir-369 7: 164349248-164349317 [+]
mml-mir-410 7: 164349561-164349640 [+]
mml-mir-656 7: 164350374-164350451 [+]
Database links

Mature sequence mml-miR-412-5p

Accession MIMAT0026871
Sequence

19 - 

uggucgaccaguuggaaagu

 - 38

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-412-3p

Accession MIMAT0006318
Sequence

54 - 

acuucaccugguccacuagccgu

 - 76

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).