Stem-loop sequence mml-mir-411

AccessionMI0007735 (change log)
DescriptionMacaca mulatta miR-411 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   u      ug   a a    a      a a       - uuu 
5'  gguacu  gag g uagu gaccgu u gcguacg c   a
    ||||||  ||| | |||| |||||| | ||||||| |   u
3'  cuauga  cuc c auca cuggca a uguaugc g   c
   a      --   c a    c      c a       a ugu 
Get sequence
Deep sequencing
192371 reads, 1.1e+03 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163358629-163358710 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-411
mml-mir-379chr7: 163357370-163357436 [+]
mml-mir-411chr7: 163358629-163358710 [+]
mml-mir-299chr7: 163359095-163359157 [+]
mml-mir-380chr7: 163360318-163360378 [+]
mml-mir-323achr7: 163361034-163361119 [+]
mml-mir-758chr7: 163361327-163361414 [+]
mml-mir-329-1chr7: 163362091-163362174 [+]
mml-mir-329-2chr7: 163362410-163362489 [+]
mml-mir-494chr7: 163364071-163364151 [+]
mml-mir-543chr7: 163366417-163366496 [+]
mml-mir-495chr7: 163368266-163368347 [+]
Database links

Mature sequence mml-miR-411-5p

Accession MIMAT0006317
Sequence

16 - 

uaguagaccguauagcguacg

 - 36

Get sequence
Deep sequencing190457 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-411-3p

Accession MIMAT0026870
Sequence

51 - 

uauguaacacgguccacuaac

 - 71

Get sequence
Deep sequencing1912 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).