Stem-loop sequence mml-mir-410

Accession MI0007734
Description Macaca mulatta miR-410 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
     c      g    ug      a  a     - uuuu 
gguac ugagga aggu  ucugug ug guucg c    a
||||| |||||| ||||  |||||| || ||||| |     
ccaug acuuuu uccg  agacac au uaagc g    u
     -      g    gu      a  a     a uaau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164349561-164349640 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-410
mml-mir-323b 7: 164340154-164340210 [+]
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
mml-mir-541 7: 164348143-164348226 [+]
mml-mir-409 7: 164348951-164349029 [+]
mml-mir-412 7: 164349098-164349188 [+]
mml-mir-369 7: 164349248-164349317 [+]
mml-mir-410 7: 164349561-164349640 [+]
mml-mir-656 7: 164350374-164350451 [+]
Database links

Mature sequence mml-miR-410-5p

Accession MIMAT0026869
Sequence

14 - 

agguugucugugaugaguucg

 - 34

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-410-3p

Accession MIMAT0006316
Sequence

50 - 

aauauaacacagauggccugu

 - 70

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).