Stem-loop sequence mml-mir-410

AccessionMI0007734 (change log)
DescriptionMacaca mulatta miR-410 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
        c      g    ug      a  a     - uuuu 
5' gguac ugagga aggu  ucugug ug guucg c    a
   ||||| |||||| ||||  |||||| || ||||| |     
3' ccaug acuuuu uccg  agacac au uaagc g    u
        -      g    gu      a  a     a uaau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163399706-163399785 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-410
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
mml-mir-369chr7: 163399393-163399462 [+]
mml-mir-410chr7: 163399706-163399785 [+]
mml-mir-656chr7: 163400519-163400596 [+]
Database links

Mature sequence mml-miR-410-5p

Accession MIMAT0026869
Sequence

14 - 

agguugucugugaugaguucg

 - 34

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-410-3p

Accession MIMAT0006316
Sequence

50 - 

aauauaacacagauggccugu

 - 70

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).