Stem-loop sequence mml-mir-410

AccessionMI0007734
DescriptionMacaca mulatta miR-410 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
     c      g    ug      a  a     - uuuu 
gguac ugagga aggu  ucugug ug guucg c    a
||||| |||||| ||||  |||||| || ||||| |     
ccaug acuuuu uccg  agacac au uaagc g    u
     -      g    gu      a  a     a uaau 
Get sequence
Deep sequencing
11610 reads, 160 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164964276-164964355 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-410
mml-mir-323bchr7: 164954659-164954715 [+]
mml-mir-154chr7: 164958168-164958251 [+]
mml-mir-496chr7: 164959019-164959120 [+]
mml-mir-377chr7: 164960414-164960482 [+]
mml-mir-541chr7: 164962858-164962941 [+]
mml-mir-409chr7: 164963666-164963744 [+]
mml-mir-412chr7: 164963813-164963903 [+]
mml-mir-369chr7: 164963963-164964032 [+]
mml-mir-410chr7: 164964276-164964355 [+]
mml-mir-656chr7: 164965089-164965166 [+]
Database links

Mature sequence mml-miR-410-5p

Accession MIMAT0026869
Sequence

14 - 

agguugucugugaugaguucg

 - 34

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-410-3p

Accession MIMAT0006316
Sequence

50 - 

aauauaacacagauggccugu

 - 70

Get sequence
Deep sequencing10 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).