Stem-loop sequence mml-mir-409

Accession MI0007733
Description Macaca mulatta miR-409 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u     u  gg   a    ac         -    - auc 
5'  gguac cg  gag gguu  ccgagcaac uuug c   u
    ||||| ||  ||| ||||  ||||||||| |||| |    
3'  cuaug gc  uuc ccaa  ggcucguug aagc g   g
   a     -  uu   c    gu         u    a cag 
Get sequence
Deep sequencing
9235 reads, 181 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164963666-164963744 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-409
mml-mir-668 chr7: 164953688-164953753 [+]
mml-mir-485 chr7: 164953852-164953924 [+]
mml-mir-323b chr7: 164954659-164954715 [+]
mml-mir-154 chr7: 164958168-164958251 [+]
mml-mir-496 chr7: 164959019-164959120 [+]
mml-mir-377 chr7: 164960414-164960482 [+]
mml-mir-541 chr7: 164962858-164962941 [+]
mml-mir-409 chr7: 164963666-164963744 [+]
mml-mir-412 chr7: 164963813-164963903 [+]
mml-mir-369 chr7: 164963963-164964032 [+]
mml-mir-410 chr7: 164964276-164964355 [+]
mml-mir-656 chr7: 164965089-164965166 [+]
Database links

Mature sequence mml-miR-409-5p

Accession MIMAT0006314
Sequence

15 - 

agguuacccgagcaacuuugcau

 - 37

Get sequence
Deep sequencing 1279 reads, 8 experiments
Evidence by similarity; MI0001735
Predicted targets

Mature sequence mml-miR-409-3p

Accession MIMAT0006315
Sequence

47 - 

gaauguugcucggugaaccccu

 - 68

Get sequence
Deep sequencing 46 reads, 7 experiments
Evidence by similarity; MI0001735
Predicted targets

References

1