Stem-loop sequence mml-mir-409

AccessionMI0007733 (change log)
DescriptionMacaca mulatta miR-409 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u     u  gg   a    ac         -    - auc 
5'  gguac cg  gag gguu  ccgagcaac uuug c   u
    ||||| ||  ||| ||||  ||||||||| |||| |    
3'  cuaug gc  uuc ccaa  ggcucguug aagc g   g
   a     -  uu   c    gu         u    a cag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163399096-163399174 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-409
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
mml-mir-369chr7: 163399393-163399462 [+]
mml-mir-410chr7: 163399706-163399785 [+]
mml-mir-656chr7: 163400519-163400596 [+]
Database links

Mature sequence mml-miR-409-5p

Accession MIMAT0006314
Sequence

15 - 

agguuacccgagcaacuuugcau

 - 37

Get sequence
Evidence by similarity; MI0001735
Database links
Predicted targets

Mature sequence mml-miR-409-3p

Accession MIMAT0006315
Sequence

47 - 

gaauguugcucggugaaccccu

 - 68

Get sequence
Evidence by similarity; MI0001735
Database links
Predicted targets

References

1