Stem-loop sequence mml-mir-409

Accession MI0007733
Description Macaca mulatta miR-409 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
u     u  gg   a    ac         -    - auc 
 gguac cg  gag gguu  ccgagcaac uuug c   u
 ||||| ||  ||| ||||  ||||||||| |||| |    
 cuaug gc  uuc ccaa  ggcucguug aagc g   g
a     -  uu   c    gu         u    a cag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164348951-164349029 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-409
mml-mir-668 7: 164339183-164339248 [+]
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-323b 7: 164340154-164340210 [+]
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
mml-mir-541 7: 164348143-164348226 [+]
mml-mir-409 7: 164348951-164349029 [+]
mml-mir-412 7: 164349098-164349188 [+]
mml-mir-369 7: 164349248-164349317 [+]
mml-mir-410 7: 164349561-164349640 [+]
mml-mir-656 7: 164350374-164350451 [+]
Database links

Mature sequence mml-miR-409-5p

Accession MIMAT0006314
Sequence

15 - 

agguuacccgagcaacuuugcau

 - 37

Get sequence
Evidence by similarity; MI0001735
Predicted targets

Mature sequence mml-miR-409-3p

Accession MIMAT0006315
Sequence

47 - 

gaauguugcucggugaaccccu

 - 68

Get sequence
Evidence by similarity; MI0001735
Predicted targets

References

1