Stem-loop sequence mml-mir-384

Accession MI0007732
Description Macaca mulatta miR-384 stem-loop
Gene family MIPF0000289; mir-384
Stem-loop
uguuaaauuaggaauuguaaacaauuccua    a    u     g   a  a a 
                              ggca uaug auaau uuc ua g c
                              |||| |||| ||||| ||| || | a
                              ccgu auac uguua aag au c u
-----------------------acaaugu    a    u     -   -  c u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 75596277-75596364 [-]
intergenic
Database links

Mature sequence mml-miR-384

Accession MIMAT0006313
Sequence

57 - 

auuccuagaaauuguucaua

 - 76

Get sequence
Evidence by similarity; MI0001145
Predicted targets

References

1