Stem-loop sequence mml-mir-384

AccessionMI0007732 (change log)
DescriptionMacaca mulatta miR-384 stem-loop
Gene family MIPF0000289; mir-384
   uguuaaauuaggaauuguaaacaauuccua    a    u     g   a  a a 
5'                               ggca uaug auaau uuc ua g c
                                 |||| |||| ||||| ||| || | a
3'                               ccgu auac uguua aag au c u
   -----------------------acaaugu    a    u     -   -  c u 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 70894088-70894175 [-]
ENSMMUT00000031764 ; ATRX-202; intron 29
ENSMMUT00000047933 ; ATRX-201; intron 30
Database links

Mature sequence mml-miR-384

Accession MIMAT0006313

57 - 


 - 76

Get sequence
Evidence by similarity; MI0001145
Predicted targets
