Stem-loop sequence mml-mir-383

AccessionMI0007731 (change log)
DescriptionMacaca mulatta miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
      -c  a      aa    a        uug   gga 
5' cuc  uc gaucag  ggug uuguggcu   ggu   u
   |||  || ||||||  |||| ||||||||   |||    
3' gag  ag cugguc  ucac gacaccga   cua   a
      aa  a      cg    -        ---   auu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 14506082-14506154 [-]
intergenic
Database links

Mature sequence mml-miR-383

Accession MIMAT0006312
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Evidence by similarity; MI0000791
Database links
Predicted targets

References

1