Stem-loop sequence mml-mir-383

Accession MI0007731
Description Macaca mulatta miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
   -c  a      aa    a        uug   gga 
cuc  uc gaucag  ggug uuguggcu   ggu   u
|||  || ||||||  |||| ||||||||   |||    
gag  ag cugguc  ucac gacaccga   cua   a
   aa  a      cg    -        ---   auu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
8: 14705721-14705793 [-]
intergenic
Database links

Mature sequence mml-miR-383

Accession MIMAT0006312
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Evidence by similarity; MI0000791
Predicted targets

References

1