Stem-loop sequence mml-mir-383

AccessionMI0007731
DescriptionMacaca mulatta miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
   -c  a      aa    a        uug   gga 
cuc  uc gaucag  ggug uuguggcu   ggu   u
|||  || ||||||  |||| ||||||||   |||    
gag  ag cugguc  ucac gacaccga   cua   a
   aa  a      cg    -        ---   auu 
Get sequence
Deep sequencing
11145 reads, 210 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 14709002-14709074 [-]
intergenic
Database links

Mature sequence mml-miR-383

Accession MIMAT0006312
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Deep sequencing12 reads, 3 experiments
Evidence by similarity; MI0000791
Predicted targets

References

1