Stem-loop sequence mml-mir-382

AccessionMI0007730 (change log)
DescriptionMacaca mulatta miR-382 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
       u       -a           ug      - uuu 
5' uacu gaagaga  guuguucgugg  gauucg c   a
   |||| |||||||  |||||||||||  |||||| |   c
3' auga cuuuuuu  caacaggcacu  cuaagc g   u
       -       ca           ua      a uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163388320-163388395 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-382
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
mml-mir-487achr7: 163386465-163386544 [+]
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
Database links

Mature sequence mml-miR-382-5p

Accession MIMAT0006311
Sequence

11 - 

gaaguuguucgugguggauucg

 - 32

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-382-3p

Accession MIMAT0026868
Sequence

47 - 

aaucauucacggacaacacuuuu

 - 69

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).