Stem-loop sequence mml-mir-382

Accession MI0007730
Description Macaca mulatta miR-382 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
       u       -a           ug      - uuu 
5' uacu gaagaga  guuguucgugg  gauucg c   a
   |||| |||||||  |||||||||||  |||||| |   c
3' auga cuuuuuu  caacaggcacu  cuaagc g   u
       -       ca           ua      a uau 
Get sequence
Deep sequencing
34340 reads, 478 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164952738-164952813 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-382
mml-mir-381 chr7: 164944340-164944414 [+]
mml-mir-487b chr7: 164944875-164944958 [+]
mml-mir-539 chr7: 164945731-164945808 [+]
mml-mir-889 chr7: 164946308-164946386 [+]
mml-mir-544 chr7: 164947069-164947159 [+]
mml-mir-487a chr7: 164950883-164950962 [+]
mml-mir-382 chr7: 164952738-164952813 [+]
mml-mir-134 chr7: 164953119-164953191 [+]
mml-mir-668 chr7: 164953688-164953753 [+]
mml-mir-485 chr7: 164953852-164953924 [+]
mml-mir-323b chr7: 164954659-164954715 [+]
mml-mir-154 chr7: 164958168-164958251 [+]
mml-mir-496 chr7: 164959019-164959120 [+]
mml-mir-377 chr7: 164960414-164960482 [+]
Database links

Mature sequence mml-miR-382-5p

Accession MIMAT0006311
Sequence

11 - 

gaaguuguucgugguggauucg

 - 32

Get sequence
Deep sequencing 56 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-382-3p

Accession MIMAT0026868
Sequence

47 - 

aaucauucacggacaacacuuuu

 - 69

Get sequence
Deep sequencing 15 reads, 4 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).