Stem-loop sequence mml-mir-381

AccessionMI0007729 (change log)
DescriptionMacaca mulatta miR-381 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         a  c   g        u        --g   u 
5' uacuua ag gag uugcccuu guauauuc   guu a
   |||||| || ||| |||||||| ||||||||   |||  
3' augagu uc cuc aacgggaa cauauaag   cag u
         g  u   g        -        gua   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163379925-163379999 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-381
mml-mir-376cchr7: 163373697-163373762 [+]
mml-mir-376a-2chr7: 163374075-163374154 [+]
mml-mir-654chr7: 163374225-163374305 [+]
mml-mir-376bchr7: 163374442-163374541 [+]
mml-mir-376a-1chr7: 163374788-163374855 [+]
mml-mir-1185-2chr7: 163376994-163377052 [+]
mml-mir-1185-1chr7: 163378194-163378303 [+]
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
mml-mir-487achr7: 163386465-163386544 [+]
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
Database links

Mature sequence mml-miR-381-5p

Accession MIMAT0026867
Sequence

8 - 

agcgagguugcccuuuguauauu

 - 30

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-381-3p

Accession MIMAT0006310
Sequence

49 - 

uauacaagggcaagcucucugu

 - 70

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).