Stem-loop sequence mml-mir-380

AccessionMI0007728 (change log)
DescriptionMacaca mulatta miR-380 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
         guu       ga       c   c 
5' aagaug   gaccaua  acaugcg uau u
   ||||||   |||||||  ||||||| |||  
3' uucugc   cugguau  uguaugc gug c
         -ac       aa       u   u 
Get sequence
Deep sequencing
3002 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163360318-163360378 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-380
mml-mir-379chr7: 163357370-163357436 [+]
mml-mir-411chr7: 163358629-163358710 [+]
mml-mir-299chr7: 163359095-163359157 [+]
mml-mir-380chr7: 163360318-163360378 [+]
mml-mir-323achr7: 163361034-163361119 [+]
mml-mir-758chr7: 163361327-163361414 [+]
mml-mir-329-1chr7: 163362091-163362174 [+]
mml-mir-329-2chr7: 163362410-163362489 [+]
mml-mir-494chr7: 163364071-163364151 [+]
mml-mir-543chr7: 163366417-163366496 [+]
mml-mir-495chr7: 163368266-163368347 [+]
Database links

Mature sequence mml-miR-380-5p

Accession MIMAT0026866
Sequence

4 - 

augguugaccauagaacaugcg

 - 25

Get sequence
Deep sequencing803 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-380-3p

Accession MIMAT0006309
Sequence

40 - 

uauguaauaugguccacgucuu

 - 61

Get sequence
Deep sequencing2199 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).