Stem-loop sequence mml-mir-379

AccessionMI0007727 (change log)
DescriptionMacaca mulatta miR-379 stem-loop
Gene family MIPF0000126; mir-379
Literature search

1 open access papers mention mml-mir-379
(1 sentences)

Stem-loop
       a    a       ga       -  uu u 
5' agag uggu gacuaug  acguagg cg  a g
   |||| |||| |||||||  ||||||| ||  |  
3' ucuc auca cugguac  uguaucc gu  u a
       a    c       aa       a  uu u 
Get sequence
Deep sequencing
341381 reads, 1.99e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163357370-163357436 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-379
mml-mir-379chr7: 163357370-163357436 [+]
mml-mir-411chr7: 163358629-163358710 [+]
mml-mir-299chr7: 163359095-163359157 [+]
mml-mir-380chr7: 163360318-163360378 [+]
mml-mir-323achr7: 163361034-163361119 [+]
mml-mir-758chr7: 163361327-163361414 [+]
mml-mir-329-1chr7: 163362091-163362174 [+]
mml-mir-329-2chr7: 163362410-163362489 [+]
mml-mir-494chr7: 163364071-163364151 [+]
mml-mir-543chr7: 163366417-163366496 [+]
Database links

Mature sequence mml-miR-379-5p

Accession MIMAT0006308
Sequence

6 - 

ugguagacuauggaacguagg

 - 26

Get sequence
Deep sequencing339608 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-379-3p

Accession MIMAT0026865
Sequence

44 - 

uauguaacaugguccacuaac

 - 64

Get sequence
Deep sequencing1773 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).