Stem-loop sequence mml-mir-377

Accession MI0007725
Description Macaca mulatta miR-377 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   uu              c   -    a    - uuu 
5'   gagcagagguugcc uug guga uucg c   a
     |||||||||||||| ||| |||| |||| |   u
3'   uuuguuuucaacgg aac cacu aagu g   u
   -g              a   a    -    u uau 
Get sequence
Deep sequencing
867 reads, 15.7 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164960414-164960482 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-377
mml-mir-487a chr7: 164950883-164950962 [+]
mml-mir-382 chr7: 164952738-164952813 [+]
mml-mir-134 chr7: 164953119-164953191 [+]
mml-mir-668 chr7: 164953688-164953753 [+]
mml-mir-485 chr7: 164953852-164953924 [+]
mml-mir-323b chr7: 164954659-164954715 [+]
mml-mir-154 chr7: 164958168-164958251 [+]
mml-mir-496 chr7: 164959019-164959120 [+]
mml-mir-377 chr7: 164960414-164960482 [+]
mml-mir-541 chr7: 164962858-164962941 [+]
mml-mir-409 chr7: 164963666-164963744 [+]
mml-mir-412 chr7: 164963813-164963903 [+]
mml-mir-369 chr7: 164963963-164964032 [+]
mml-mir-410 chr7: 164964276-164964355 [+]
mml-mir-656 chr7: 164965089-164965166 [+]
Database links

Mature sequence mml-miR-377-5p

Accession MIMAT0026864
Sequence

7 - 

agagguugcccuuggugaauuc

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-377-3p

Accession MIMAT0006306
Sequence

45 - 

aucacacaaaggcaacuuuugu

 - 66

Get sequence
Deep sequencing 15 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).