Stem-loop sequence mml-mir-377

Accession MI0007725
Description Macaca mulatta miR-377 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
uu              c   -    a    - uuu 
  gagcagagguugcc uug guga uucg c   a
  |||||||||||||| ||| |||| |||| |   u
  uuuguuuucaacgg aac cacu aagu g   u
-g              a   a    -    u uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164345705-164345773 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-377
mml-mir-487a 7: 164336378-164336457 [+]
mml-mir-382 7: 164338233-164338308 [+]
mml-mir-134 7: 164338614-164338686 [+]
mml-mir-668 7: 164339183-164339248 [+]
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-323b 7: 164340154-164340210 [+]
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
mml-mir-541 7: 164348143-164348226 [+]
mml-mir-409 7: 164348951-164349029 [+]
mml-mir-412 7: 164349098-164349188 [+]
mml-mir-369 7: 164349248-164349317 [+]
mml-mir-410 7: 164349561-164349640 [+]
mml-mir-656 7: 164350374-164350451 [+]
Database links

Mature sequence mml-miR-377-5p

Accession MIMAT0026864
Sequence

7 - 

agagguugcccuuggugaauuc

 - 28

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-377-3p

Accession MIMAT0006306
Sequence

45 - 

aucacacaaaggcaacuuuugu

 - 66

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).