Stem-loop sequence mml-mir-376c

Accession MI0007724
Description Macaca mulatta miR-376c stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
       g     ua     u         uguua 
5' aaaa gugga  uuccu cuauguuua     u
   |||| |||||  ||||| |||||||||     u
3' uuuu caccu  aagga gauacaaau     u
       g     ua     -         uggua 
Get sequence
Deep sequencing
1388 reads, 24.9 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164938114-164938179 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-376c
mml-mir-494 chr7: 164928535-164928615 [+]
mml-mir-543 chr7: 164930881-164930960 [+]
mml-mir-495 chr7: 164932634-164932715 [+]
mml-mir-376c chr7: 164938114-164938179 [+]
mml-mir-376a-2 chr7: 164938492-164938571 [+]
mml-mir-654 chr7: 164938642-164938722 [+]
mml-mir-376b chr7: 164938859-164938958 [+]
mml-mir-376a-1 chr7: 164939205-164939272 [+]
mml-mir-1185-2 chr7: 164941410-164941468 [+]
mml-mir-1185-1 chr7: 164942609-164942718 [+]
mml-mir-381 chr7: 164944340-164944414 [+]
mml-mir-487b chr7: 164944875-164944958 [+]
mml-mir-539 chr7: 164945731-164945808 [+]
mml-mir-889 chr7: 164946308-164946386 [+]
mml-mir-544 chr7: 164947069-164947159 [+]
Database links

Mature sequence mml-miR-376c-5p

Accession MIMAT0026863
Sequence

6 - 

guggauauuccuucuauguuua

 - 27

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-376c-3p

Accession MIMAT0006305
Sequence

43 - 

aacauagaggaaauuccacgu

 - 63

Get sequence
Deep sequencing 3 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).