Stem-loop sequence mml-mir-376b

AccessionMI0007723 (change log)
DescriptionMacaca mulatta miR-376b stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
       ccuuc         u           a     u     uuuacg    u 
5' cagu     uuugguauu aaaacguggau uuccu cuaug      ugau c
   ||||     ||||||||| ||||||||||| ||||| |||||      |||| c
3' gucg     aaacuauga uuuuguaccua aagga gauac      auug u
       ----u         c           a     -     ----ua    g 
Get sequence
Deep sequencing
2401 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163374442-163374541 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-376b
mml-mir-543chr7: 163366417-163366496 [+]
mml-mir-495chr7: 163368266-163368347 [+]
mml-mir-376cchr7: 163373697-163373762 [+]
mml-mir-376a-2chr7: 163374075-163374154 [+]
mml-mir-654chr7: 163374225-163374305 [+]
mml-mir-376bchr7: 163374442-163374541 [+]
mml-mir-376a-1chr7: 163374788-163374855 [+]
mml-mir-1185-2chr7: 163376994-163377052 [+]
mml-mir-1185-1chr7: 163378194-163378303 [+]
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
Database links

Mature sequence mml-miR-376b-5p

Accession MIMAT0026862
Sequence

24 - 

cguggauauuccuucuauguuua

 - 46

Get sequence
Deep sequencing540 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-376b-3p

Accession MIMAT0006304
Sequence

62 - 

aucauagaggaaaauccauguu

 - 83

Get sequence
Deep sequencing1853 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).