Stem-loop sequence mml-mir-376a-2

AccessionMI0007722 (change log)
DescriptionMacaca mulatta miR-376a-2 stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
         u    g  a         u         --   g 
5' gguauu aaaa gu gauuuuccu cuaugguua  cgu u
   |||||| |||| || ||||||||| |||||||||  ||| u
3' cuauga uuuu ca cuaaaagga gauacuaau  gua u
         c    g  c         -         ug   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163374075-163374154 [+]
intergenic
JSUE03276506.1: 244-323 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-376a-2
mml-mir-543chr7: 163366417-163366496 [+]
mml-mir-495chr7: 163368266-163368347 [+]
mml-mir-376cchr7: 163373697-163373762 [+]
mml-mir-376a-2chr7: 163374075-163374154 [+]
mml-mir-654chr7: 163374225-163374305 [+]
mml-mir-376bchr7: 163374442-163374541 [+]
mml-mir-376a-1chr7: 163374788-163374855 [+]
mml-mir-1185-2chr7: 163376994-163377052 [+]
mml-mir-1185-1chr7: 163378194-163378303 [+]
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
Database links

Mature sequence mml-miR-376a-2-5p

Accession MIMAT0031082
Sequence

13 - 

guagauuuuccuucuaugguu

 - 33

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-376a-3p

Accession MIMAT0006303
Sequence

50 - 

aucauagaggaaaauccacgu

 - 70

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).