Stem-loop sequence mml-mir-376a-2

AccessionMI0007722
DescriptionMacaca mulatta miR-376a-2 stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
      u    g  a         u         --   g 
gguauu aaaa gu gauuuuccu cuaugguua  cgu u
|||||| |||| || ||||||||| |||||||||  ||| u
cuauga uuuu ca cuaaaagga gauacuaau  gua u
      c    g  c         -         ug   g 
Get sequence
Deep sequencing
558 reads, 13.8 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164938492-164938571 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-376a-2
mml-mir-494chr7: 164928535-164928615 [+]
mml-mir-543chr7: 164930881-164930960 [+]
mml-mir-495chr7: 164932634-164932715 [+]
mml-mir-376cchr7: 164938114-164938179 [+]
mml-mir-376a-2chr7: 164938492-164938571 [+]
mml-mir-654chr7: 164938642-164938722 [+]
mml-mir-376bchr7: 164938859-164938958 [+]
mml-mir-376a-1chr7: 164939205-164939272 [+]
mml-mir-1185-2chr7: 164941410-164941468 [+]
mml-mir-1185-1chr7: 164942609-164942718 [+]
mml-mir-381chr7: 164944340-164944414 [+]
mml-mir-487bchr7: 164944875-164944958 [+]
mml-mir-539chr7: 164945731-164945808 [+]
mml-mir-889chr7: 164946308-164946386 [+]
mml-mir-544chr7: 164947069-164947159 [+]
Database links

Mature sequence mml-miR-376a-2-5p

Accession MIMAT0031082
Sequence

13 - 

guagauuuuccuucuaugguu

 - 33

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-376a-3p

Accession MIMAT0006303
Sequence

50 - 

aucauagaggaaaauccacgu

 - 70

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).