Stem-loop sequence mml-mir-376a-2

Accession MI0007722
Description Macaca mulatta miR-376a-2 stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
      u    g  a         u         --   g 
gguauu aaaa gu gauuuuccu cuaugguua  cgu u
|||||| |||| || ||||||||| |||||||||  ||| u
cuauga uuuu ca cuaaaagga gauacuaau  gua u
      c    g  c         -         ug   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164324567-164324646 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-376a-2
mml-mir-543 7: 164316909-164316988 [+]
mml-mir-495 7: 164318758-164318839 [+]
mml-mir-376c 7: 164324189-164324254 [+]
mml-mir-376a-2 7: 164324567-164324646 [+]
mml-mir-654 7: 164324717-164324797 [+]
mml-mir-376b 7: 164324934-164325033 [+]
mml-mir-376a-1 7: 164325280-164325347 [+]
mml-mir-1185-2 7: 164327486-164327544 [+]
mml-mir-1185-1 7: 164328686-164328795 [+]
mml-mir-381 7: 164330417-164330491 [+]
mml-mir-487b 7: 164330952-164331035 [+]
mml-mir-539 7: 164331808-164331885 [+]
mml-mir-889 7: 164332385-164332463 [+]
mml-mir-544 7: 164333144-164333234 [+]
Database links

Mature sequence mml-miR-376a-2-5p

Accession MIMAT0031082
Sequence

13 - 

guagauuuuccuucuaugguu

 - 33

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-376a-3p

Accession MIMAT0006303
Sequence

50 - 

aucauagaggaaaauccacgu

 - 70

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).