|
miRBase |
|
Stem-loop sequence mml-mir-376a-1 |
|||||
| Accession | MI0007721 | ||||
| Description | Macaca mulatta miR-376a-1 stem-loop | ||||
| Gene family | MIPF0000091; mir-368 | ||||
| Stem-loop |
u g a c u --gua u aaaa gu gauu uccu cuauga cau a |||| || |||| |||| |||||| ||| u uuuu ca cuaa agga gauacu gua u c g c a - aauua u |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence mml-miR-376a |
|
| Accession | MIMAT0006303 |
| Sequence |
44 - aucauagaggaaaauccacgu - 64 |
| Evidence | by similarity; MI0000784 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|