Stem-loop sequence mml-mir-374b

Accession MI0007719
Description Macaca mulatta miR-374b stem-loop
Gene family MIPF0000288; mir-374
Stem-loop
--  u    ug au                     c 
  ac cgga  g  auaauacaaccugcuaagugu c
  || ||||  |  |||||||||||||||||||||  
  ug gccu  u  uauuauguuggacgauucacg u
uc  u    gu ac                     a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 73312006-73312077 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-374b
mml-mir-374b X: 73312006-73312077 [-]
mml-mir-421 X: 73311841-73311919 [-]
Database links

Mature sequence mml-miR-374b-5p

Accession MIMAT0006301
Sequence

11 - 

auauaauacaaccugcuaagug

 - 32

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-374b-3p

Accession MIMAT0026860
Sequence

42 - 

uuagcagguuguauuaucauu

 - 62

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).