Stem-loop sequence mml-mir-374b

Accession MI0007719
Description Macaca mulatta miR-374b stem-loop
Gene family MIPF0000288; mir-374
Stem-loop
   --  u    ug au                     c 
5'   ac cgga  g  auaauacaaccugcuaagugu c
     || ||||  |  |||||||||||||||||||||  
3'   ug gccu  u  uauuauguuggacgauucacg u
   uc  u    gu ac                     a 
Get sequence
Deep sequencing
7521 reads, 154 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 73878234-73878305 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-374b
mml-mir-374b chrX: 73878234-73878305 [-]
mml-mir-421 chrX: 73878069-73878147 [-]
Database links

Mature sequence mml-miR-374b-5p

Accession MIMAT0006301
Sequence

11 - 

auauaauacaaccugcuaagug

 - 32

Get sequence
Deep sequencing 93 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-374b-3p

Accession MIMAT0026860
Sequence

42 - 

uuagcagguuguauuaucauu

 - 62

Get sequence
Deep sequencing 3 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).