Stem-loop sequence mml-mir-374a

AccessionMI0007718 (change log)
DescriptionMacaca mulatta miR-374a stem-loop
Gene family MIPF0000288; mir-374
Literature search

2 open access papers mention mml-mir-374a
(3 sentences)

Stem-loop
        c   c            c           u 
5' uacau ggc auuauaauacaa cugauaagugu a
   ||||| ||| |||||||||||| |||||||||||  
3' augug cug uaauguuauguu gacuauucacg c
        u   u            a           a 
Get sequence
Deep sequencing
82175 reads, 711 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 68840608-68840679 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-374a
mml-mir-374achrX: 68840608-68840679 [-]
mml-mir-545chrX: 68840424-68840529 [-]
Database links

Mature sequence mml-miR-374a-5p

Accession MIMAT0006300
Sequence

12 - 

uuauaauacaaccugauaagug

 - 33

Get sequence
Deep sequencing4218 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-374a-3p

Accession MIMAT0026859
Sequence

42 - 

cuuaucagauuguauuguaauu

 - 63

Get sequence
Deep sequencing77957 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).