|
miRBase |
|
Stem-loop sequence mml-mir-373 |
||||||||||
| Accession | MI0007717 | |||||||||
| Description | Macaca mulatta miR-373 stem-loop | |||||||||
| Gene family | MIPF0000500; mir-373 | |||||||||
| Stem-loop |
- g u uuuug gggauaccc aaaau ggagcacuu ccc u ||||||||| ||||| ||||||||| ||| c cccuguggg uuuua cuucgugaa ggg u g g - ucgug |
|||||||||
| Genome context |
|
|||||||||
| Clustered miRNAs |
|
|||||||||
| Database links |
|
|||||||||
Mature sequence mml-miR-373 |
|
| Accession | MIMAT0006299 |
| Sequence |
44 - gaagugcuucgauuuuggggugu - 66 |
| Evidence | by similarity; MI0000781 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|