Stem-loop sequence mml-mir-373

AccessionMI0007717 (change log)
DescriptionMacaca mulatta miR-373 stem-loop
Gene family MIPF0000500; mir-373
Stem-loop
            -     g         u   uuuug 
5' gggauaccc aaaau ggagcacuu ccc     u
   ||||||||| ||||| ||||||||| |||     c
3' cccuguggg uuuua cuucgugaa ggg     u
            g     g         -   ucgug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49142984-49143052 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-373
mml-mir-371chr19: 49142068-49142137 [+]
mml-mir-372chr19: 49142277-49142343 [+]
mml-mir-373chr19: 49142984-49143052 [+]
Database links

Mature sequence mml-miR-373

Accession MIMAT0006299
Sequence

44 - 

gaagugcuucgauuuuggggugu

 - 66

Get sequence
Evidence by similarity; MI0000781
Predicted targets

References

1