Stem-loop sequence mml-mir-373

Accession MI0007717
Description Macaca mulatta miR-373 stem-loop
Gene family MIPF0000500; mir-373
Stem-loop
         -     g         u   uuuug 
gggauaccc aaaau ggagcacuu ccc     u
||||||||| ||||| ||||||||| |||     c
cccuguggg uuuua cuucgugaa ggg     u
         g     g         -   ucgug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59899307-59899375 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-373
mml-mir-371-1 19: 59895652-59895721 [+]
mml-mir-371-2 19: 59898391-59898460 [+]
mml-mir-372 19: 59898600-59898666 [+]
mml-mir-373 19: 59899307-59899375 [+]
Database links

Mature sequence mml-miR-373

Accession MIMAT0006299
Sequence

44 - 

gaagugcuucgauuuuggggugu

 - 66

Get sequence
Evidence by similarity; MI0000781
Predicted targets

References

1