Stem-loop sequence mml-mir-373

AccessionMI0007717
DescriptionMacaca mulatta miR-373 stem-loop
Gene family MIPF0000500; mir-373
Stem-loop
         -     g         u   uuuug 
gggauaccc aaaau ggagcacuu ccc     u
||||||||| ||||| ||||||||| |||     c
cccuguggg uuuua cuucgugaa ggg     u
         g     g         -   ucgug 
Get sequence
Deep sequencing
1743 reads, 475 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59628940-59629008 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-373
mml-mir-371-1chr19: 59628022-59628091 [+]
mml-mir-372chr19: 59628231-59628297 [+]
mml-mir-373chr19: 59628940-59629008 [+]
Database links

Mature sequence mml-miR-373

Accession MIMAT0006299
Sequence

44 - 

gaagugcuucgauuuuggggugu

 - 66

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0000781
Predicted targets

References

1