Stem-loop sequence mml-mir-372

AccessionMI0007716
DescriptionMacaca mulatta miR-372 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
     c         g -      a    gaug 
gugau cucaaaugu g agcacu uucu    u
||||| ||||||||| | |||||| ||||    c
cacug gaguuuaca c ucguga aagg    c
     c         g g      -    ugaa 
Get sequence
Deep sequencing
954 reads, 246 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59628231-59628297 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-372
mml-mir-371-1chr19: 59628022-59628091 [+]
mml-mir-372chr19: 59628231-59628297 [+]
mml-mir-373chr19: 59628940-59629008 [+]
Database links

Mature sequence mml-miR-372-5p

Accession MIMAT0026858
Sequence

6 - 

ccucaaauguggagcacuauucu

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-372-3p

Accession MIMAT0006298
Sequence

42 - 

aaagugcugcgacauuugagcgu

 - 64

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).