Stem-loop sequence mml-mir-372

Accession MI0007716
Description Macaca mulatta miR-372 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
     c         g -      a    gaug 
gugau cucaaaugu g agcacu uucu    u
||||| ||||||||| | |||||| ||||    c
cacug gaguuuaca c ucguga aagg    c
     c         g g      -    ugaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59898600-59898666 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-372
mml-mir-371-1 19: 59895652-59895721 [+]
mml-mir-371-2 19: 59898391-59898460 [+]
mml-mir-372 19: 59898600-59898666 [+]
mml-mir-373 19: 59899307-59899375 [+]
Database links

Mature sequence mml-miR-372-5p

Accession MIMAT0026858
Sequence

6 - 

ccucaaauguggagcacuauucu

 - 28

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-372-3p

Accession MIMAT0006298
Sequence

42 - 

aaagugcugcgacauuugagcgu

 - 64

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).