Stem-loop sequence mml-mir-371

AccessionMI0007715 (change log)
Previous IDsmml-mir-371
DescriptionMacaca mulatta miR-371 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
               cu    g        cug u u 
5' guggcacucaaa  gugg ggcacuuu   c c c
   ||||||||||||  |||| ||||||||   | |  
3' cauugugaguuu  uacc ccgugaaa   g g u
               ug    g        aaa u g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49142068-49142137 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-371
mml-mir-371chr19: 49142068-49142137 [+]
mml-mir-372chr19: 49142277-49142343 [+]
mml-mir-373chr19: 49142984-49143052 [+]
Database links

Mature sequence mml-miR-371-5p

Accession MIMAT0006296
Sequence

6 - 

acucaaacugugggggcacu

 - 25

Get sequence
Evidence by similarity; MI0000779
Predicted targets

Mature sequence mml-miR-371-3p

Accession MIMAT0006297
Sequence

45 - 

aagugccgccauguuuugagugu

 - 67

Get sequence
Evidence by similarity; MI0000779
Predicted targets

References

1