Stem-loop sequence mml-mir-371-1

AccessionMI0007715
Previous IDsmml-mir-371
DescriptionMacaca mulatta miR-371-1 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
            cu    g        cug u u 
guggcacucaaa  gugg ggcacuuu   c c c
||||||||||||  |||| ||||||||   | |  
cauugugaguuu  uacc ccgugaaa   g g u
            ug    g        aaa u g 
Get sequence
Deep sequencing
169 reads, 109 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59628022-59628091 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-371-1
mml-mir-371-1chr19: 59628022-59628091 [+]
mml-mir-372chr19: 59628231-59628297 [+]
mml-mir-373chr19: 59628940-59629008 [+]
Database links

Mature sequence mml-miR-371-5p

Accession MIMAT0006296
Sequence

6 - 

acucaaacugugggggcacu

 - 25

Get sequence
Evidence by similarity; MI0000779
Predicted targets

Mature sequence mml-miR-371-3p

Accession MIMAT0006297
Sequence

45 - 

aagugccgccauguuuugagugu

 - 67

Get sequence
Evidence by similarity; MI0000779
Predicted targets

References

1