|
miRBase |
|
Stem-loop sequence mml-mir-371-1 |
||||||||||
| Accession | MI0007715 | |||||||||
| Previous IDs | mml-mir-371 | |||||||||
| Description | Macaca mulatta miR-371-1 stem-loop | |||||||||
| Gene family | MIPF0000068; mir-290 | |||||||||
| Stem-loop |
cu g cug u u guggcacucaaa gugg ggcacuuu c c c |||||||||||| |||| |||||||| | | cauugugaguuu uacc ccgugaaa g g u ug g aaa u g |
|||||||||
| Genome context |
|
|||||||||
| Clustered miRNAs |
|
|||||||||
| Database links |
|
|||||||||
Mature sequence mml-miR-371-5p |
|
| Accession | MIMAT0006296 |
| Sequence |
6 - acucaaacugugggggcacu - 25 |
| Evidence | by similarity; MI0000779 |
| Predicted targets |
|
Mature sequence mml-miR-371-3p |
|
| Accession | MIMAT0006297 |
| Sequence |
45 - aagugccgccauguuuugagugu - 67 |
| Evidence | by similarity; MI0000779 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|