Stem-loop sequence mml-mir-370

AccessionMI0007714
DescriptionMacaca mulatta miR-370 stem-loop
Gene family MIPF0000167; mir-370
Stem-loop
      agaa       ca gu   u    u   a  g 
agacag    gccaggu  c  cuc gcag uac ca c
||||||    |||||||  |  ||| |||| ||| || u
ucuguc    uggucca  g  ggg cguc gug gu c
      ----       ag ug   u    c   a  a 
Get sequence
Deep sequencing
32292 reads, 439 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164809276-164809350 [+]
intergenic
Database links

Mature sequence mml-miR-370-5p

Accession MIMAT0026857
Sequence

13 - 

caggucacgucucugcaguuac

 - 34

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-370-3p

Accession MIMAT0006295
Sequence

48 - 

gccugcugggguggaaccuggu

 - 69

Get sequence
Deep sequencing58 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).