Stem-loop sequence mml-mir-370

Accession MI0007714
Description Macaca mulatta miR-370 stem-loop
Gene family MIPF0000167; mir-370
Stem-loop
      agaa       ca gu   u    u   a  g 
agacag    gccaggu  c  cuc gcag uac ca c
||||||    |||||||  |  ||| |||| ||| || u
ucuguc    uggucca  g  ggg cguc gug gu c
      ----       ag ug   u    c   a  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164195455-164195529 [+]
intergenic
Database links

Mature sequence mml-miR-370-5p

Accession MIMAT0026857
Sequence

13 - 

caggucacgucucugcaguuac

 - 34

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-370-3p

Accession MIMAT0006295
Sequence

48 - 

gccugcugggguggaaccuggu

 - 69

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).