Stem-loop sequence mml-mir-369

AccessionMI0007713 (change log)
DescriptionMacaca mulatta miR-369 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u   ag               ua      cuuua 
5'  uga  ggagaucgaccgugu  uauucg     u
    |||  |||||||||||||||  ||||||      
3'  acu  uuucuaguugguaca  auaagc     u
   g   cu               ua      uucag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163399393-163399462 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-369
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
mml-mir-369chr7: 163399393-163399462 [+]
mml-mir-410chr7: 163399706-163399785 [+]
mml-mir-656chr7: 163400519-163400596 [+]
Database links

Mature sequence mml-miR-369-5p

Accession MIMAT0006293
Sequence

9 - 

agaucgaccguguuauauucgc

 - 30

Get sequence
Evidence by similarity; MI0000777
Predicted targets

Mature sequence mml-miR-369-3p

Accession MIMAT0006294
Sequence

44 - 

aauaauacaugguugaucuuu

 - 64

Get sequence
Evidence by similarity; MI0000777
Database links
Predicted targets

References

1