Stem-loop sequence mml-mir-369

Accession MI0007713
Description Macaca mulatta miR-369 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
u   ag               ua      cuuua 
 uga  ggagaucgaccgugu  uauucg     u
 |||  |||||||||||||||  ||||||      
 acu  uuucuaguugguaca  auaagc     u
g   cu               ua      uucag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164349248-164349317 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-369
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-323b 7: 164340154-164340210 [+]
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
mml-mir-541 7: 164348143-164348226 [+]
mml-mir-409 7: 164348951-164349029 [+]
mml-mir-412 7: 164349098-164349188 [+]
mml-mir-369 7: 164349248-164349317 [+]
mml-mir-410 7: 164349561-164349640 [+]
mml-mir-656 7: 164350374-164350451 [+]
Database links

Mature sequence mml-miR-369-5p

Accession MIMAT0006293
Sequence

9 - 

agaucgaccguguuauauucgc

 - 30

Get sequence
Evidence by similarity; MI0000777
Predicted targets

Mature sequence mml-miR-369-3p

Accession MIMAT0006294
Sequence

44 - 

aauaauacaugguugaucuuu

 - 64

Get sequence
Evidence by similarity; MI0000777
Predicted targets

References

1