Stem-loop sequence mml-mir-369

AccessionMI0007713
DescriptionMacaca mulatta miR-369 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
u   ag               ua      cuuua 
 uga  ggagaucgaccgugu  uauucg     u
 |||  |||||||||||||||  ||||||      
 acu  uuucuaguugguaca  auaagc     u
g   cu               ua      uucag 
Get sequence
Deep sequencing
3665 reads, 63 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164963963-164964032 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-369
mml-mir-323bchr7: 164954659-164954715 [+]
mml-mir-154chr7: 164958168-164958251 [+]
mml-mir-496chr7: 164959019-164959120 [+]
mml-mir-377chr7: 164960414-164960482 [+]
mml-mir-541chr7: 164962858-164962941 [+]
mml-mir-409chr7: 164963666-164963744 [+]
mml-mir-412chr7: 164963813-164963903 [+]
mml-mir-369chr7: 164963963-164964032 [+]
mml-mir-410chr7: 164964276-164964355 [+]
mml-mir-656chr7: 164965089-164965166 [+]
Database links

Mature sequence mml-miR-369-5p

Accession MIMAT0006293
Sequence

9 - 

agaucgaccguguuauauucgc

 - 30

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence by similarity; MI0000777
Predicted targets

Mature sequence mml-miR-369-3p

Accession MIMAT0006294
Sequence

44 - 

aauaauacaugguugaucuuu

 - 64

Get sequence
Deep sequencing80 reads, 6 experiments
Evidence by similarity; MI0000777
Predicted targets

References

1