Stem-loop sequence mml-mir-367

Accession MI0007712
Description Macaca mulatta miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
   c            ua     c   --g   a 
cca uacuguugcuaa  ugcaa ucu   uug a
||| ||||||||||||  ||||| |||   |||  
ggu gugguaacgauu  acguu agg   aac c
   a            uc     a   uua   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
5: 105472060-105472127 [-]
antisense
ENSMMUT00000025168 ; MMU.2273-201; intron 6
Clustered miRNAs
< 10kb from mml-mir-367
mml-mir-302b 5: 105472668-105472743 [-]
mml-mir-302c 5: 105472533-105472600 [-]
mml-mir-302a 5: 105472356-105472424 [-]
mml-mir-302d 5: 105472190-105472257 [-]
mml-mir-367 5: 105472060-105472127 [-]
Database links

Mature sequence mml-miR-367

Accession MIMAT0006292
Sequence

44 - 

aauugcacuuuagcaaugguga

 - 65

Get sequence
Evidence by similarity; MI0000775
Predicted targets

References

1