Stem-loop sequence mml-mir-367

Accession MI0007712
Description Macaca mulatta miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
      c            ua     c   --g   a 
5' cca uacuguugcuaa  ugcaa ucu   uug a
   ||| ||||||||||||  ||||| |||   |||  
3' ggu gugguaacgauu  acguu agg   aac c
      a            uc     a   uua   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr5: 106770911-106770978 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-367
mml-mir-302b chr5: 106771519-106771594 [-]
mml-mir-302c chr5: 106771384-106771451 [-]
mml-mir-302a chr5: 106771207-106771275 [-]
mml-mir-302d chr5: 106771041-106771108 [-]
mml-mir-367 chr5: 106770911-106770978 [-]
Database links

Mature sequence mml-miR-367

Accession MIMAT0006292
Sequence

44 - 

aauugcacuuuagcaaugguga

 - 65

Get sequence
Evidence by similarity; MI0000775
Predicted targets

References

1