Stem-loop sequence mml-mir-367

AccessionMI0007712 (change log)
DescriptionMacaca mulatta miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
      c            ua     c   --g   a 
5' cca uacuguugcuaa  ugcaa ucu   uug a
   ||| ||||||||||||  ||||| |||   |||  
3' ggu gugguaacgauu  acguu agg   aac c
      a            uc     a   uua   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 111570284-111570351 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-367
mml-mir-302bchr5: 111570892-111570967 [-]
mml-mir-302cchr5: 111570757-111570824 [-]
mml-mir-302achr5: 111570580-111570648 [-]
mml-mir-302dchr5: 111570414-111570481 [-]
mml-mir-367chr5: 111570284-111570351 [-]
Database links

Mature sequence mml-miR-367

Accession MIMAT0006292
Sequence

44 - 

aauugcacuuuagcaaugguga

 - 65

Get sequence
Evidence by similarity; MI0000775
Predicted targets

References

1