Stem-loop sequence mml-mir-365-2

Accession MI0007711
Description Macaca mulatta miR-365-2 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
agaguguucaa g   --       a        ac   c       -----    u   u 
           g aca  gcaagaa aaugaggg  uuu aggggca     gcug guu u
           | |||  ||||||| ||||||||  ||| |||||||     |||| |||  
           c ugu  cguucuu uuauuccu  aaa uccccgu     ugac cag c
-----ggacua g   ga       g        aa   -       aauac    u   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 26755289-26755399 [+]
intergenic
Database links

Mature sequence mml-miR-365-2-5p

Accession MIMAT0031081
Sequence

28 - 

gagggacuuucaggggcagcugu

 - 50

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-365-3p

Accession MIMAT0006291
Sequence

68 - 

uaaugccccuaaaaauccuuau

 - 89

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).