Stem-loop sequence mml-mir-365-2

AccessionMI0007711 (change log)
DescriptionMacaca mulatta miR-365-2 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   agaguguucaa g   --       a        ac   c       -----    u   u 
5'            g aca  gcaagaa aaugaggg  uuu aggggca     gcug guu u
              | |||  ||||||| ||||||||  ||| |||||||     |||| |||  
3'            c ugu  cguucuu uuauuccu  aaa uccccgu     ugac cag c
   -----ggacua g   ga       g        aa   -       aauac    u   u 
Get sequence
Deep sequencing
2626 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 25667229-25667339 [+]
sense
ENSMMUT00000042013 ; RHOT1-202; intron 1
ENSMMUT00000042012 ; RHOT1-201; intron 1
ENSMMUT00000024751 ; RHOT1-203; intron 1
ENSMMUT00000042011 ; RHOT1-204; intron 1
ENSMMUT00000042010 ; RHOT1-205; intron 1
Database links

Mature sequence mml-miR-365-2-5p

Accession MIMAT0031081
Sequence

28 - 

gagggacuuucaggggcagcugu

 - 50

Get sequence
Deep sequencing360 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-365-3p

Accession MIMAT0006291
Sequence

68 - 

uaaugccccuaaaaauccuuau

 - 89

Get sequence
Deep sequencing4518 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).