|
miRBase |
|
Stem-loop sequence mml-mir-365-1 |
||||||
| Accession | MI0007710 | |||||
| Description | Macaca mulatta miR-365-1 stem-loop | |||||
| Gene family | MIPF0000061; mir-365 | |||||
| Stem-loop |
acc aa ac ---- - uuu gcaggg aaugaggg uuuugggggca gau gug c |||||| |||||||| ||||||||||| ||| ||| c cguucu uuauuccu aaaauccccgu cua cac a --a cg -a aaua u cuu |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence mml-miR-365 |
|
| Accession | MIMAT0006291 |
| Sequence |
56 - uaaugccccuaaaaauccuuau - 77 |
| Evidence | by similarity; MI0000767 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|