Stem-loop sequence mml-mir-365-1

AccessionMI0007710
DescriptionMacaca mulatta miR-365-1 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
acc      aa        ac           ----   -   uuu 
   gcaggg  aaugaggg  uuuugggggca    gau gug   c
   ||||||  ||||||||  |||||||||||    ||| |||   c
   cguucu  uuauuccu  aaaauccccgu    cua cac   a
--a      cg        -a           aaua   u   cuu 
Get sequence
Deep sequencing
1926 reads, 64.3 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr20: 14465097-14465183 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-365-1
mml-mir-193bchr20: 14459743-14459825 [+]
mml-mir-365-1chr20: 14465097-14465183 [+]
Database links

Mature sequence mml-miR-365-1-5p

Accession MIMAT0026856
Sequence

15 - 

gagggacuuuugggggcagaugu

 - 37

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-365-3p

Accession MIMAT0006291
Sequence

56 - 

uaaugccccuaaaaauccuuau

 - 77

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).