|
miRBase |
|
Stem-loop sequence mml-mir-363 |
|||||
| Accession | MI0007709 | ||||
| Description | Macaca mulatta miR-363 stem-loop | ||||
| Gene family | MIPF0000138; mir-363 | ||||
| Stem-loop |
u gu ca a --ga gu guu cggguggau cg ugcaauuuu uua a ||| ||||||||| || ||||||||| ||| caa gucuaccua gc acguuaaaa gau u c au ug - agag ac |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence mml-miR-363 |
|
| Accession | MIMAT0006290 |
| Sequence |
50 - aauugcacgguauccaucugua - 71 |
| Evidence | by similarity; MI0000764 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|