Stem-loop sequence mml-mir-363

Accession MI0007709
Description Macaca mulatta miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
u   gu         ca  a         --ga   gu 
 guu  cggguggau  cg ugcaauuuu    uua  a
 |||  |||||||||  || |||||||||    |||   
 caa  gucuaccua  gc acguuaaaa    gau  u
c   au         ug  -         agag   ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 132386867-132386941 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-363
mml-mir-106a X: 132387687-132387767 [-]
mml-mir-18b X: 132387530-132387600 [-]
mml-mir-20b X: 132387298-132387366 [-]
mml-mir-19b-2 X: 132387160-132387255 [-]
mml-mir-92a-2 X: 132387027-132387101 [-]
mml-mir-363 X: 132386867-132386941 [-]
Database links

Mature sequence mml-miR-363-5p

Accession MIMAT0026855
Sequence

7 - 

cggguggaucacgaugcaauuuu

 - 29

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-363-3p

Accession MIMAT0006290
Sequence

50 - 

aauugcacgguauccaucugua

 - 71

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).