Stem-loop sequence mml-mir-363

AccessionMI0007709 (change log)
DescriptionMacaca mulatta miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   u   gu         ca  a         --ga   gu 
5'  guu  cggguggau  cg ugcaauuuu    uua  a
    |||  |||||||||  || |||||||||    |||   
3'  caa  gucuaccua  gc acguuaaaa    gau  u
   c   au         ug  -         agag   ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128131733-128131807 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-363
mml-mir-106achrX: 128132553-128132633 [-]
mml-mir-18bchrX: 128132396-128132466 [-]
mml-mir-20bchrX: 128132164-128132232 [-]
mml-mir-19b-2chrX: 128132026-128132121 [-]
mml-mir-92a-2chrX: 128131893-128131967 [-]
mml-mir-363chrX: 128131733-128131807 [-]
Database links

Mature sequence mml-miR-363-5p

Accession MIMAT0026855
Sequence

7 - 

cggguggaucacgaugcaauuuu

 - 29

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-363-3p

Accession MIMAT0006290
Sequence

50 - 

aauugcacgguauccaucugua

 - 71

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).