Stem-loop sequence mml-mir-363

Accession MI0007709
Description Macaca mulatta miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   u   gu         ca  a         --ga   gu 
5'  guu  cggguggau  cg ugcaauuuu    uua  a
    |||  |||||||||  || |||||||||    |||   
3'  caa  gucuaccua  gc acguuaaaa    gau  u
   c   au         ug  -         agag   ac 
Get sequence
Deep sequencing
21885 reads, 449 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 133484326-133484400 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-363
mml-mir-106a chrX: 133485146-133485226 [-]
mml-mir-18b chrX: 133484989-133485059 [-]
mml-mir-20b chrX: 133484757-133484825 [-]
mml-mir-19b-2 chrX: 133484619-133484714 [-]
mml-mir-92a-2 chrX: 133484486-133484560 [-]
mml-mir-363 chrX: 133484326-133484400 [-]
Database links

Mature sequence mml-miR-363-5p

Accession MIMAT0026855
Sequence

7 - 

cggguggaucacgaugcaauuuu

 - 29

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-363-3p

Accession MIMAT0006290
Sequence

50 - 

aauugcacgguauccaucugua

 - 71

Get sequence
Deep sequencing 62 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).