Stem-loop sequence mml-mir-362

Accession MI0007708
Description Macaca mulatta miR-362 stem-loop
Gene family MIPF0000209; mir-362
Stem-loop
cuc           acc        -a ug  a 
   gaauccuugga   uaggugug  g  cu u
   |||||||||||   ||||||||  |  || u
   cuuaggaacuu   auccacac  c  ga u
aaa           ---        aa gu  c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 47644032-47644096 [+]
sense
ENSMMUT00000032444 ; CLCN5-201; intron 3
Clustered miRNAs
< 10kb from mml-mir-362
mml-mir-532 X: 47638245-47638322 [+]
mml-mir-188 X: 47638603-47638688 [+]
mml-mir-500a X: 47643501-47643584 [+]
mml-mir-362 X: 47644032-47644096 [+]
mml-mir-501 X: 47644792-47644875 [+]
mml-mir-500b X: 47647191-47647251 [+]
mml-mir-660 X: 47649746-47649842 [+]
mml-mir-502 X: 47651105-47651184 [+]
Database links

Mature sequence mml-miR-362-5p

Accession MIMAT0006288
Sequence

5 - 

aauccuuggaaccuaggugugagu

 - 28

Get sequence
Evidence by similarity; MI0000762
Predicted targets

Mature sequence mml-miR-362-3p

Accession MIMAT0006289
Sequence

42 - 

aacacaccuauucaaggauuca

 - 63

Get sequence
Evidence by similarity; MI0000762
Predicted targets

References

1