Stem-loop sequence mml-mir-362

AccessionMI0007708
DescriptionMacaca mulatta miR-362 stem-loop
Gene family MIPF0000209; mir-362
Stem-loop
cuc           acc        -a ug  a 
   gaauccuugga   uaggugug  g  cu u
   |||||||||||   ||||||||  |  || u
   cuuaggaacuu   auccacac  c  ga u
aaa           ---        aa gu  c 
Get sequence
Deep sequencing
881 reads, 36.2 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
JH290886.1: 39196-39260 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-362
mml-mir-532JH290886.1: 33403-33480 [+]
mml-mir-188JH290886.1: 33761-33846 [+]
mml-mir-500aJH290886.1: 38665-38748 [+]
mml-mir-362JH290886.1: 39196-39260 [+]
mml-mir-501JH290886.1: 39956-40039 [+]
mml-mir-500bJH290886.1: 42676-42736 [+]
mml-mir-660JH290886.1: 45211-45307 [+]
mml-mir-502JH290886.1: 46570-46649 [+]
Database links

Mature sequence mml-miR-362-5p

Accession MIMAT0006288
Sequence

5 - 

aauccuuggaaccuaggugugagu

 - 28

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence by similarity; MI0000762
Predicted targets

Mature sequence mml-miR-362-3p

Accession MIMAT0006289
Sequence

42 - 

aacacaccuauucaaggauuca

 - 63

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0000762
Predicted targets

References

1