Stem-loop sequence mml-mir-362

AccessionMI0007708 (change log)
DescriptionMacaca mulatta miR-362 stem-loop
Gene family MIPF0000209; mir-362
Stem-loop
   cuc           acc        -a ug  a 
5'    gaauccuugga   uaggugug  g  cu u
      |||||||||||   ||||||||  |  || u
3'    cuuaggaacuu   auccacac  c  ga u
   aaa           ---        aa gu  c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 50014025-50014089 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-362
mml-mir-532chrX: 50008220-50008297 [+]
mml-mir-188chrX: 50008578-50008663 [+]
mml-mir-500achrX: 50013494-50013577 [+]
mml-mir-362chrX: 50014025-50014089 [+]
mml-mir-501chrX: 50014785-50014868 [+]
mml-mir-500bchrX: 50017286-50017346 [+]
mml-mir-660chrX: 50020567-50020663 [+]
mml-mir-502chrX: 50021926-50022005 [+]
Database links

Mature sequence mml-miR-362-5p

Accession MIMAT0006288
Sequence

5 - 

aauccuuggaaccuaggugugagu

 - 28

Get sequence
Evidence by similarity; MI0000762
Predicted targets

Mature sequence mml-miR-362-3p

Accession MIMAT0006289
Sequence

42 - 

aacacaccuauucaaggauuca

 - 63

Get sequence
Evidence by similarity; MI0000762
Predicted targets

References

1