Stem-loop sequence mml-mir-361

Accession MI0007707
Description Macaca mulatta miR-361 stem-loop
Gene family MIPF0000172; mir-361
Stem-loop
     uu         --u  a    u     auaa 
ggagc  aucagaauc   cc gggg acuuu    u
|||||  |||||||||   || |||| |||||     
cuucg  uagucuuag   gg cccc ugaaa    u
     uu         ugu  a    c     aacu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 84714873-84714944 [-]
sense
ENSMMUT00000023568 ; CHM-201; intron 9
Database links

Mature sequence mml-miR-361-5p

Accession MIMAT0006286
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Evidence by similarity; MI0000760
Predicted targets

Mature sequence mml-miR-361-3p

Accession MIMAT0006287
Sequence

45 - 

ucccccaggugugauucugauuu

 - 67

Get sequence
Evidence by similarity; MI0000760
Predicted targets

References

1