Stem-loop sequence mml-mir-361

AccessionMI0007707
DescriptionMacaca mulatta miR-361 stem-loop
Gene family MIPF0000172; mir-361
Stem-loop
     uu         --u  a    u     auaa 
ggagc  aucagaauc   cc gggg acuuu    u
|||||  |||||||||   || |||| |||||     
cuucg  uagucuuag   gg cccc ugaaa    u
     uu         ugu  a    c     aacu 
Get sequence
Deep sequencing
17605 reads, 319 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 85280852-85280923 [-]
antisense
ENSMMUT00000023569 ; DACH2-202; intron 3
ENSMMUT00000023570 ; DACH2-201; intron 4
Database links

Mature sequence mml-miR-361-5p

Accession MIMAT0006286
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Deep sequencing39 reads, 6 experiments
Evidence by similarity; MI0000760
Predicted targets

Mature sequence mml-miR-361-3p

Accession MIMAT0006287
Sequence

45 - 

ucccccaggugugauucugauuu

 - 67

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence by similarity; MI0000760
Predicted targets

References

1