Stem-loop sequence mml-mir-346

AccessionMI0007706 (change log)
DescriptionMacaca mulatta miR-346 stem-loop
Gene family MIPF0000188; mir-346
   ------   ug       --  augccugccucucuguugcucuga 
5'       guc  ucugccc  gc                        a
         |||  |||||||  ||                         
3'       cgg  agacggg  cg                        g
   cguccu   cg       uc  ucgacguccgggucggggacggag 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 46022041-46022126 [+]
Database links

Mature sequence mml-miR-346

Accession MIMAT0006285

4 - 


 - 26

Get sequence
Evidence by similarity; MI0000826
Predicted targets
