Stem-loop sequence mml-mir-346

Accession MI0007706
Description Macaca mulatta miR-346 stem-loop
Gene family MIPF0000188; mir-346
Stem-loop
------   ug       --  augccugccucucuguugcucuga 
      guc  ucugccc  gc                        a
      |||  |||||||  ||                         
      cgg  agacggg  cg                        g
cguccu   cg       uc  ucgacguccgggucggggacggag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
9: 51005354-51005439 [+]
sense
ENSMMUT00000036584 ; mml-mir-346-201; exon 1
ENSMMUT00000033217 ; GRID1-201; intron 2
Database links

Mature sequence mml-miR-346

Accession MIMAT0006285
Sequence

4 - 

ugucugcccgcaugccugccucu

 - 26

Get sequence
Evidence by similarity; MI0000826
Predicted targets

References

1