Stem-loop sequence mml-mir-346

Accession MI0007706
Description Macaca mulatta miR-346 stem-loop
Gene family MIPF0000188; mir-346
   ------   ug       --  augccugccucucuguugcucuga 
5'       guc  ucugccc  gc                        a
         |||  |||||||  ||                         
3'       cgg  agacggg  cg                        g
   cguccu   cg       uc  ucgacguccgggucggggacggag 
Get sequence
Deep sequencing
37 reads, 1.3 reads per million, 3 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr9: 48854528-48854613 [+]
Database links

Mature sequence mml-miR-346

Accession MIMAT0006285

4 - 


 - 26

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence by similarity; MI0000826
Predicted targets
