Stem-loop sequence mml-mir-346

AccessionMI0007706
DescriptionMacaca mulatta miR-346 stem-loop
Gene family MIPF0000188; mir-346
Stem-loop
------   ug       --  augccugccucucuguugcucuga 
      guc  ucugccc  gc                        a
      |||  |||||||  ||                         
      cgg  agacggg  cg                        g
cguccu   cg       uc  ucgacguccgggucggggacggag 
Get sequence
Deep sequencing
37 reads, 1.3 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr9: 48854528-48854613 [+]
intergenic
Database links

Mature sequence mml-miR-346

Accession MIMAT0006285
Sequence

4 - 

ugucugcccgcaugccugccucu

 - 26

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0000826
Predicted targets

References

1